Compound immunopotentiator, inactivated vaccine for poultry, and preparation method thereof

A technology of immune enhancer and inactivated vaccine, which is applied in the field of poultry inactivated vaccine and its preparation, and compound immune enhancer, which can solve the problems of difficult absorption, increased production cost, increased vaccine side effects, etc., to reduce the amount of antigen , prolonging the duration of antibody and shortening the immune window period

Inactive Publication Date: 2012-11-28
JIANGSU ACAD OF AGRI SCI
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, simply increasing the antibody titer by increasing the antigen content of Haemophilus paragallinarum will not only increase the production cost, but also increase the side effects of the vaccine, making it difficult to absorb

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compound immunopotentiator, inactivated vaccine for poultry, and preparation method thereof
  • Compound immunopotentiator, inactivated vaccine for poultry, and preparation method thereof
  • Compound immunopotentiator, inactivated vaccine for poultry, and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Preparation of Compound Immunity Booster and Poultry Vaccine

[0035] (1) Test material

[0036] The nucleic acid sequence containing the CpG motif is shown in SEQ ID NO.1, specifically: 5'-GTTCCTGACGTTGGTGCATCGATGCAGGGGGGTCGTCGTTTTGTCGTTTTGTCGTTGGGGGGTCGTCGTTTTGTCGTTTTGTCGTTGGGGGGTCGTTTTGTCGTTTTGTCGTTGGGGGGCTAGACGTTAGCGT-3', by. β-glucan and α-galactosylceramide (α-galactosylceramide, α-GC for short) were purchased from Invivogen. Levamisole was purchased from SIGMA Company. White oil was purchased from Esso, France, and Tween-80 and Span-80 were purchased from Guangdong Zhaoqing Chaoneng Industrial Co., Ltd. Inorganic salts for preparing phosphate buffer were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0037] (2) Test method

[0038] Preparation of compound immune enhancer:

[0039] Preparation of aqueous phase solution: first prepare phosphate (PBS) buffer solution containing 1.44g / L Na 2 HPO 4 , KH of 1.44g / L 2 PO 4 , 8g / L NaCl...

Embodiment 2

[0060] Example 2 Effect of Compound Immunopotentiator on Immune Efficacy and Antibody Duration of H9 Subtype Avian Influenza Vaccine

[0061] (1) Test material

[0062] H9 subtype avian influenza vaccine and H9 subtype avian influenza standard detection antigen were purchased from Nanjing Tianbang Biotechnology Co., Ltd. White oil for seedling preparation was purchased from Esso, Marcol 52, France, and Tween-80 and Span-80 were purchased from Guangdong Zhaoqing Chaoneng Industrial Co., Ltd. Specific Pathogen Free (SPF) chickens purchased chicken embryos from Beijing Meria Weitong Experimental Animal Technology Co., Ltd., and were reared in isolators after self-hatching until 28 days old.

[0063] Adopt existing H9 subtype avian influenza vaccine, prepare the H9 subtype avian influenza vaccine A-VA2, B-VA2 and C-VA2 containing compound immunopotentiator according to the first method of embodiment 1, abbreviated as A-VA2 respectively -H9, B-VA2-H9, C-VA2-H9.

[0064] In o...

Embodiment 3

[0085] Example 3 Compound Immunopotentiator Reduces Antigen Consumption in H9 Subtype Avian Influenza Vaccine

[0086] (1) Test material

[0087] The existing H9 subtype avian influenza vaccine (antigen is inactivated H9N2 subtype avian influenza virus NJ / 02 strain) and H9 avian influenza detection antigen and inactivated H9N2 subtype avian influenza virus NJ / 02 strain were purchased from Nanjing Tianbang Biotechnology Co., Ltd. Technology Co., Ltd.

[0088] Adopt the first method of embodiment 1, mix with existing H9 subtype avian influenza vaccine with compound immunostimulant, prepare antigen content respectively and be 1 / 2, 1 / 2 of the antigen content in the existing H9 subtype avian influenza vaccine 4 and 1 / 10 of the vaccine. According to the second preparation method in Example 1, the inactivated H9 subtype avian influenza virus NJ / 02 strain was used to prepare a vaccine with the same antigenic amount as the existing H9 subtype avian influenza vaccine. The composi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a compound immunopotentiator and an application in preparation of veterinary vaccines. The compound immunopotentiator contains 0.5-100 microgram / mL of nucleic acid sequence with a CpG motif, 0.5-1000 microgram / mL of alpha-galactosyl ceramide, 5-2000 microgram / mL of beta-glucan, and 5-2000 microgram / mL of levomisole, wherein the nucleic acid sequence with a CpG motif is shown in SEQ ID NO.1. When the compound immunopotentiator of the invention is mixed with an H9-subtype avian influenza inactivated vaccine, the immune window period is shortened by 2 weeks; the antibody persistent period is prolonged by 8 weeks; sterilizing immunity protection is provided for H9-subtype homotype strain attack; and the antigen content for preparing vaccines is reduced.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a compound immune enhancer, an inactivated vaccine for poultry and a preparation method thereof. Background technique [0002] Inactivated vaccines for various infectious diseases of livestock and poultry have played an important role in the prevention and control of these diseases. The use of inactivated vaccines is expected to achieve eliminative immunity, that is, to completely protect the body from the infection of such diseases after receiving a certain vaccine immunization, or not to shed the virus after infection, and not to spread the virus to other animals. However, there are still some defects in the application of existing vaccines, and the quality of vaccines needs to be further improved. These deficiencies include the following. [0003] After the existing inactivated vaccine immunizes the body, the antibody production is slow, the antibody duration is short, and the ant...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K39/39A61K39/145A61K39/102A61K39/12A61K39/17A61K31/215A61K39/235A61P31/14A61P31/16A61P31/20
Inventor唐应华陆吉虎吴培培刘振兴田震何家惠侯继波
OwnerJIANGSU ACAD OF AGRI SCI