Compound immunopotentiator, inactivated vaccine for poultry, and preparation method thereof
A technology of immune enhancer and inactivated vaccine, which is applied in the field of poultry inactivated vaccine and its preparation, and compound immune enhancer, which can solve the problems of difficult absorption, increased production cost, increased vaccine side effects, etc., to reduce the amount of antigen , prolonging the duration of antibody and shortening the immune window period
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Preparation of Compound Immunity Booster and Poultry Vaccine
[0035] (1) Test material
[0036] The nucleic acid sequence containing the CpG motif is shown in SEQ ID NO.1, specifically: 5'-GTTCCTGACGTTGGTGCATCGATGCAGGGGGGTCGTCGTTTTGTCGTTTTGTCGTTGGGGGGTCGTCGTTTTGTCGTTTTGTCGTTGGGGGGTCGTTTTGTCGTTTTGTCGTTGGGGGGCTAGACGTTAGCGT-3', by. β-glucan and α-galactosylceramide (α-galactosylceramide, α-GC for short) were purchased from Invivogen. Levamisole was purchased from SIGMA Company. White oil was purchased from Esso, France, and Tween-80 and Span-80 were purchased from Guangdong Zhaoqing Chaoneng Industrial Co., Ltd. Inorganic salts for preparing phosphate buffer were purchased from Sinopharm Chemical Reagent Co., Ltd.
[0037] (2) Test method
[0038] Preparation of compound immune enhancer:
[0039] Preparation of aqueous phase solution: first prepare phosphate (PBS) buffer solution containing 1.44g / L Na 2 HPO 4 , KH of 1.44g / L 2 PO 4 , 8g / L NaCl...
Embodiment 2
[0060] Example 2 Effect of Compound Immunopotentiator on Immune Efficacy and Antibody Duration of H9 Subtype Avian Influenza Vaccine
[0061] (1) Test material
[0062] H9 subtype avian influenza vaccine and H9 subtype avian influenza standard detection antigen were purchased from Nanjing Tianbang Biotechnology Co., Ltd. White oil for seedling preparation was purchased from Esso, Marcol 52, France, and Tween-80 and Span-80 were purchased from Guangdong Zhaoqing Chaoneng Industrial Co., Ltd. Specific Pathogen Free (SPF) chickens purchased chicken embryos from Beijing Meria Weitong Experimental Animal Technology Co., Ltd., and were reared in isolators after self-hatching until 28 days old.
[0063] Adopt existing H9 subtype avian influenza vaccine, prepare the H9 subtype avian influenza vaccine A-VA2, B-VA2 and C-VA2 containing compound immunopotentiator according to the first method of embodiment 1, abbreviated as A-VA2 respectively -H9, B-VA2-H9, C-VA2-H9.
[0064] In o...
Embodiment 3
[0085] Example 3 Compound Immunopotentiator Reduces Antigen Consumption in H9 Subtype Avian Influenza Vaccine
[0086] (1) Test material
[0087] The existing H9 subtype avian influenza vaccine (antigen is inactivated H9N2 subtype avian influenza virus NJ / 02 strain) and H9 avian influenza detection antigen and inactivated H9N2 subtype avian influenza virus NJ / 02 strain were purchased from Nanjing Tianbang Biotechnology Co., Ltd. Technology Co., Ltd.
[0088] Adopt the first method of embodiment 1, mix with existing H9 subtype avian influenza vaccine with compound immunostimulant, prepare antigen content respectively and be 1 / 2, 1 / 2 of the antigen content in the existing H9 subtype avian influenza vaccine 4 and 1 / 10 of the vaccine. According to the second preparation method in Example 1, the inactivated H9 subtype avian influenza virus NJ / 02 strain was used to prepare a vaccine with the same antigenic amount as the existing H9 subtype avian influenza vaccine. The composi...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap