Bacillus subtilis DJ-6 and application thereof in prevention and treatment of grape disease

A Bacillus subtilis, DJ-6 technology, applied in the application, bacteria, fungicides and other directions, can solve the problems of no mention and disclosure, and achieve the effects of low production cost, good control effect, and simple fermentation process

Inactive Publication Date: 2014-02-19
ZHENJIANG AGRI SCI INST JIANGSU HILLY AREAS
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The antagonistic bacterium Bacillus subtilis DJ-6 bacterial strain that can simultaneously cure multiple diseases of grapes provided by the present invention is not mentioned and disclosed in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus subtilis DJ-6 and application thereof in prevention and treatment of grape disease
  • Bacillus subtilis DJ-6 and application thereof in prevention and treatment of grape disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0026] The Bacillus subtilis (Bacillus subtilis in Latin) DJ-6 strain of the present invention has been preserved in the General Microorganism Center of China Microbiological Culture Collection Management Committee on July 2, 2012, and the preservation number is: CGMCC No. 6314. The cell morphology and physiological and biochemical characteristics of the bacterial strain of the present invention are shown in Table 1.

[0027] The 16S rRNA gene sequence of the Bacillus subtilis DJ-6 bacterial strain of the present embodiment is:

[0028] TATCATGCAAGTCGAGCGGACAGATGGGAGCYYGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACCTTGACGGTACCTAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to bacillus subtilis DJ-6 and a method for preparing a suspending agent from bacillus subtilis DJ-6 fermentation broth. The bacillus subtilis DJ-6 has the collection number of No.6314 in the CGMCC (China General Microbiological Culture Collection Center). The preparation can be used for effectively preventing and treating the grape anthracnose, grape room blight, spike-stalk brown rot, grey mould, anthracnose and white rot.

Description

field of invention [0001] The invention relates to a microorganism and its use, more specifically to a Bacillus subtilis (Bacillus subtilis) DJ-6 strain, its use and a preparation method for its preparation, belonging to the technical field of biological pesticides. Background technique [0002] Grape anthracnose caused by phytopathogenic fungus Glomerella cingulata, grape house blight caused by Physalospora baccae, grape ears caused by Alternaria viticola Shaft brown rot (blight), grape white rot caused by Coniothyrium dlodiella infection, grape downy mildew caused by Plasmopara viticola infection, grape ash caused by Botrytis cinerea infection Grape black pox caused by mildew and scab cavity fungus (Elsinae ampelina) infection is the main disease on grapes in my country. [0003] Grape diseases are currently mainly controlled by chemical control, and the following chemical agents are commonly used for control: thiophanate-methyl, bordeaux mixture, sodium pentachlorophenol, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/00A01P3/00C12R1/125
Inventor 杨敬辉吉沐祥姚克兵庄义庆
Owner ZHENJIANG AGRI SCI INST JIANGSU HILLY AREAS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap