Bacillus subtilis DJ-6 and application thereof in prevention and treatment of grape disease
A Bacillus subtilis, DJ-6 technology, applied in the application, bacteria, fungicides and other directions, can solve the problems of no mention and disclosure, and achieve the effects of low production cost, good control effect, and simple fermentation process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0026] The Bacillus subtilis (Bacillus subtilis in Latin) DJ-6 strain of the present invention has been preserved in the General Microorganism Center of China Microbiological Culture Collection Management Committee on July 2, 2012, and the preservation number is: CGMCC No. 6314. The cell morphology and physiological and biochemical characteristics of the bacterial strain of the present invention are shown in Table 1.
[0027] The 16S rRNA gene sequence of the Bacillus subtilis DJ-6 bacterial strain of the present embodiment is:
[0028] TATCATGCAAGTCGAGCGGACAGATGGGAGCYYGCTCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCACTTACAGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAATAGGGCGGTACCTTGACGGTACCTAA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 