Filamentous fungal host strains and DNA constructs, and methods of use thereof

A technology for filamentous fungi and fungi, which can be applied to recombinant DNA technology, botanical equipment and methods, biochemical equipment and methods, etc., and can solve problems such as not eliminating the variability of the expression level of transformants

Active Publication Date: 2013-02-20
DANISCO US INC
View PDF15 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although telomeric, extrachromosomal replicating vectors can be used as an alternative to genomic integration, this approach does not eliminate variability in expression levels between transformants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Filamentous fungal host strains and DNA constructs, and methods of use thereof
  • Filamentous fungal host strains and DNA constructs, and methods of use thereof
  • Filamentous fungal host strains and DNA constructs, and methods of use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0133] Generation of Trichoderma reesei expression strains

[0134] Improved strains are generated to increase the uniformity of expression of the variant of interest (in this case, the CBH2 variant), such that expression levels vary less between variants of the same amino acid sequence. Specifically, T. reesei strains were developed in combination with targeting vectors that force the integration of cbh2 variant genes (eg, coding regions in operative combination with regulatory sequences). New strains prepared during the development of the present invention combined several mutations that were advantageous for screening variant libraries. A schematic diagram of the genetic engineering steps is shown in figure 1 middle.

[0135] Deletion of ku80 from Trichoderma reesei quad deletion derivative strain

[0136] Quad deletion derivative strains are described in PCT Publication WO 2005 / 001036. A single ortholog of MUS52, the Neurospora crassa ortholog of human KU80, was id...

Embodiment 2

[0155] Enzyme expression comparison: Qnad deletion strain compared to MAD6 strain

[0156] 1. Preparation of vector

[0157] Expression of two glycosyl hydrolase family 43 proteins in Trichoderma reesei strains, Archy3 and quad deletion strains. use Cloning system (Invitrogen), the genes fv43B and fv43C were cloned from Fusarium verticillioides genomic DNA and assembled into expression vector pTrex3gM. Such as Figure 9 These two genes were initially cloned into the pENTR / D-TOPO vector (Invitrogen) as shown in .

[0158] The gene was then recombined into the vector pTrex3gM, in which the cbhl promoter was upstream of the coding sequence of the gene of interest and the cbhl terminator was downstream of the stop codon of the gene of interest. This vector additionally contains an Aspergillus nidulans amidase (amdS) selectable marker located 3' to the cbhl terminator. This carrier is shown in FIG. 10 .

[0159] The resulting Fv43B expression vector, pTrex3gM-Fv43B, is s...

Embodiment 3

[0203] Generation of H. jecorina CBH2 DNA library

[0204] The pTTTpyrG-cbh2 plasmid containing the H. jecorina CBH2 protein coding sequence (see eg, PCT Publication WO 2010 / 141779) was used as a reference sequence for generating a DNA library encoding CBH2 variant enzymes.

[0205] SEQ ID NO: 7 shows the reference H. jecorina CBH2 encoding DNA sequence:

[0206] ATGATTGTCGGCATTCTCACCACGCTGGCTACGCTGGCCACACTCGCAGCTAGTGTGCCTCTAGAGGAGCGGCAAGCTTGCTCAAGCGTCTGGGGCCAATGTGGTGGCCAGAATTGGTCGGGTCCGACTTGCTGTGCTTCCGGAAGCACATGCGTCTACTCCAACGACTATTACTCCCAGTGTCTTCCCGGCGCTGCAAGCTCAAGCTCGTCCACGCGCGCCGCGTCGACGACTTCTCGAGTATCCCCCACAACATCCCGGTCGAGCTCCGCGACGCCTCCACCTGGTTCTACTACTACCAGAGTACCTCCAGTCGGATCGGGAACCGCTACGTATTCAGGCAACCCTTTTGTTGGGGTCACTCCTTGGGCCAATGCATATTACGCCTCTGAAGTTAGCAGCCTCGCTATTCCTAGCTTGACTGGAGCCATGGCCACTGCTGCAGCAGCTGTCGCAAAGGTTCCCTCTTTTATGTGGCTAGATACTCTTGACAAGACCCCTCTCATGGAGCAAACCTTGGCCGACATCCGCACCGCCAACAAGAATGGCGGTAACTATGCCGGACAGTTTGTGGTGTATGACTTGCCGGATCGCGATTGCGCTGCCCTTGCCTCGAATGGCGAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present disclosure relates to filamentous fungal host strains and recombinant DNA constructs for creation and use thereof. The filamentous fungal host strains are particularly useful for achieving reliable expression of recombinant enzymes and variants.

Description

[0001] Cross references to related patent applications [0002] This patent application claims priority to US Provisional Application 61 / 351,286, filed June 3, 2010, the disclosure of which is incorporated herein by reference. technical field [0003] The present invention relates to filamentous fungal host strains and recombinant DNA constructs for their production and use. Filamentous fungal host strains are particularly useful for expressing proteins of interest in a reliable or less variable manner, and for efficient screening of DNA libraries encoding recombinant proteins. Background technique [0004] Filamentous fungal host cell strains have been engineered to express a variety of proteins. Subsequently, optionally after purification, these proteins can be used in various industrial, academic or other applications. The expression process can often be unpredictable. It is not uncommon for only a few, if any, of the transformants made to actually produce the enzyme o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12N15/00C12N5/00
CPCC12N15/80C12Y302/01091C12P21/02C12N9/2434C12N9/2437Y02P20/52
InventorB·S·鲍尔T·卡佩尔B·R·凯莱门
OwnerDANISCO US INC