Plant salt tolerance related miRNA (microribonucleic acid) and application thereof

A salt-tolerant, plant-based technology for miRNA, miRNA precursors

Inactive Publication Date: 2013-05-22
SHANDONG NORMAL UNIV
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, in the searchable prior art, the research on Salmus miRNAs has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant salt tolerance related miRNA (microribonucleic acid) and application thereof
  • Plant salt tolerance related miRNA (microribonucleic acid) and application thereof
  • Plant salt tolerance related miRNA (microribonucleic acid) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: Salt mustard seed collection and planting

[0034] Wild-type Thellungiella salsuginea (Shandong eco-type) seeds were collected in the saline-alkali land of the Yellow River Delta in Dongying City, Shandong Province, dried in the sun, and subjected to surface disinfection: 70% alcohol, treated for 1 min, 1% NaClO solution, vortexed for 10-15 min, and sterilized After rinsing with double distilled water, they were sown in petri dishes with MS medium. The temperature setting of the light incubator was: 25°C for 16h during the day and 22°C for 8h at night. After growing 2 true leaves, transfer them to Hogland liquid medium. After culturing for about 5 weeks, add NaCl to the Hogland nutrient solution to make the final concentration 200mM, and cultivate for 24 hours. The control is still Hogland nutrient solution without NaCl.

Embodiment 2

[0035] Example 2: Construction and Solexa sequencing of Salt mustard miRNA library

[0036] The samples of the salt mustard control group (CL) and the NaCl treatment group (TL) were sent to Shenzhen BGI Institute to construct the miRNAs library for Solexa sequencing. After removing 3' adapters, contaminating sequences, less than 18nt sequences and polyA sequences after sequencing, a total of 12,010,658 high-quality small RNA sequences (sRNA) were obtained in the Salina CL miRNA library, and a total of high-quality small RNA sequences were obtained in the TL miRNA library (sRNA) 12330771 entries. The result of bioinformatics prediction showed that the mature body sequence of tsa-miRn646 was UGAAGGAUCGAGGUCGAGGCA. The precursor sequence of tsa-miRn646 is AATAACAAGGTGAAGGATCGAGGTCGAGGCAGTATTGATATAGATTCAGCTCGTCCTTCACCGGTGCAAC, and its position in the genome is: scaffold_6:6637138:6637207:-. According to the precursor and mature body sequences of tsa-miRn646, use the software RNA...

Embodiment 3

[0038] Example 3: Real-time quantitative PCR verifies the expression level of tsa-miRn646 under control and 200mM NaCl treatment

[0039] (1) Primer design for tsa-miRn646 reverse transcription and Stem-loop quantitative PCR:

[0040] According to the sequence of the mature miRNA of tsa-miRn646 and the sequence of the internal standard gene - Salt mustard U6, the primers for stem-loop PCR were designed as follows:

[0041] 1) tsa-miRn646 Stem-loop RT primer:

[0042] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGCCT,

[0043] 2) tsa-miRn646 Forward primer: CGGCTGAAGGATCGAGGTCG,

[0044] 3) tsa-miR n646 Reverse primer: GTGCAGGGTCCGAGGT,

[0045] 4) U6-Forward primer: GATAAAATTGGAACGATACAG,

[0046] 5) U6-Reverse primer: ATTTGGACCATTTCTCGATTT.

[0047] As shown in SEQ ID NO: 4-8 in the sequence listing.

[0048] (2) Extraction of salt mustard miRNA

[0049] The processing and collection of salt mustard samples are the same as in Example 1.

[0050] Salt mustard miRNA was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses plant salt tolerance related miRNA (microribonucleic acid) which is derived from thellungiella halophila and named tsa-miRn646. The tsa-miRn646 has an RNA sequence shown as SEQ ID NO:1 in a sequence table; and a precursor of the tsa-miRn646 has an RNA sequence shown as SEQ ID NO:2 in the sequence table. The tsa-miRn646 disclosed by the invention can promote the mRNA (messenger ribonucleic acid) degradation of transcription factor MYB, bZIP and bHLH genes and inhibit the expression of the transcription factor MYB, bZIP and bHLH genes. By overexpressing the miRNA shown as SEQ ID NO:1 or the miRNA precursor shown as SEQ ID NO:2 or inhibiting the expression of the miRNA shown as SEQ ID NO:1 or the miRNA precursor shown as SEQ ID NO:2 in crops such as wheat, rice, corn and cotton, transgenic crops having high salt tolerance can be cultivated. The tsa-miRn646 disclosed by the invention has important meanings and potential application values in the cultivation of salt-tolerant crops.

Description

technical field [0001] The invention relates to a miRNA related to plant salt tolerance, which is a new miRNA derived from salt mustard and capable of regulating plant stress tolerance, especially salt tolerance, and the transgenic technology of the miRNA can improve the crop's Salt tolerance. The present invention also relates to the precursor of this miRNA, the coding gene of the precursor and its application. Belongs to the field of biotechnology. Background technique [0002] Soil salinization has become an important factor affecting crop growth, yield and quality, and is one of the main reasons for crop yield reduction. At present, about 20% of the arable land and at least 40% of the irrigated fields in the world have different degrees of salinization. With the rapid increase of population and the rapid development of industrialization, the area of ​​arable land has declined sharply, unreasonable irrigation, industrial pollution The aggravation of agricultural pollut...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11A01H5/00
Inventor张荃赵传志王兴军孙伟赵宝添刘艳张权赵彦修
OwnerSHANDONG NORMAL UNIV