Pig catenin alpha-like 1 (CTNNAL1) gene as genetic marker of pig litter size traits

A genetic marker and catenin technology, applied in genetic engineering, plant gene improvement, recombinant DNA technology, etc., can solve problems such as long time, no discovery, and difficulty in establishing resource families

Inactive Publication Date: 2013-05-22
HUAZHONG AGRI UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Rothschild research group (1994. A major gene for litter size in pigs. Proc 5th World Congr Genet Appl Livest Prod, Guelph, Canada, 1994, 21: 225-228) found that the B allele of ESR locus can significantly improve the The litter size of the synthetic line is 1.15 heads / litter, but there is no QTL for litter size traits found in its vicinity by genome scanning
The other is the genome scanning method, but because it is difficult to obtain resource families with litter size records, it takes a long time and the cost is high, so there are relatively few reports on the QTL mapping of litter size traits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig catenin alpha-like 1 (CTNNAL1) gene as genetic marker of pig litter size traits
  • Pig catenin alpha-like 1 (CTNNAL1) gene as genetic marker of pig litter size traits
  • Pig catenin alpha-like 1 (CTNNAL1) gene as genetic marker of pig litter size traits

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Obtaining pig CTNNAL1 gene fragments and establishing a polymorphism detection method

[0031] Log in to the NCBI database to download the corresponding human gene sequence, use the human CTNNAL1 mRNA sequence as the seed sequence, and use the NCBI website EST-others to search for homologous ESTs of pigs. Select the porcine ESTs with more than 80% homology, use electronic cloning, splice the obtained ESTs, and use this as the target sequence, and use Primer2 software to design primers online. The primer sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 5 in the sequence table, as follows: Forward primer CTNNAL1-F: CCATGCTGATCATGTGGTTC, CTNNAL1-R: CAAACCCTCCTCAGCAAAAA. PCR amplification included the fragment of exon 14 of CTNNAL1 gene. The PCR reaction system was 25 μl, in which the template DNA was 50 ng, the concentration of dNTPs was 200 μmol / L, the concentration of each primer was 0.4 μmol / L, 3 U of Taq DNA polymerase (Biostar International, Canada), and...

Embodiment 2

[0033] Example 2: Polymorphic distribution of genetic markers prepared by the present invention in different pig herds

[0034] The extraction of pig genome DNA (sample is shown in Table 1) was carried out with reference to the method introduced in Xiong Yuan's "Introduction to Pig Biochemistry and Molecular Genetic Experiments" China Agricultural Press, 1999.

[0035] In 11 groups of pigs, including 7 foreign blood herds and 3 local Chinese blood herds, 1 synthetic line (Chinese lean pig new line DIV line (co-cultivated by Huazhong Agricultural University and Institute of Animal Husbandry and Veterinary Medicine, Hubei Academy of Agricultural Sciences) , a new breed of lean-meat pig that was popularized and applied on a large scale in China) to detect the PCR-AluI-RFLP polymorphism of pig CTNNAL1 gene, and the detection results are shown in Table 1. The results show that only in large white pigs, Hubei white pigs DIV and Huainan pigs There were 3 genotypes in ; however, no CC...

Embodiment 3

[0039] Example 3: Association analysis of genetic markers prepared by the present invention and litter size traits

[0040] In order to determine whether PCR-AluI-RFLP of pig CTNNAL1 gene is related to pig phenotype differences, 120 Chinese lean pig new strain DIV lines established by the Key Laboratory of Pig Genetics and Breeding of the Ministry of Agriculture of the applicant and the Animal Husbandry and Veterinary Department of Hubei Academy of Agricultural Sciences were selected. The 142 Large White pigs in the research institute were used as test materials. The AluI-RFLP method established in Example 2 was used for polymorphism detection, and the correlation between different genotypes of pig AluI-RFLP and pig litter size traits was analyzed. The SAS statistical software (SAS Institute Inc, Version 8.0) GLM program was used for single-marker analysis of variance, and the REG program was used to calculate the additive effect and dominant effect of the gene, and the signifi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of the preparation and the application of a pig genetic marker, and concretely relates to a technology for detecting the single nucleotide polymorphism (SNP) of the fourteenth exon of a pig CTNNAL1 coding gene. The technology comprises the following steps: extracting genomic DNA from pig blood, designing a primer, carrying out PCR amplification, cloning and sequencing the obtained PCR product, carrying out sequence comparison analysis, detecting the SNP, and analyzing the correlation between the marker and the litter size traits. The invention discloses a DNA sequence of the fourteenth exon of the pig CTNNAL1 gene and an SNP typing detection technology. The nucleotide sequence of the genetic marker is represented by SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 in a sequence table, there is a base mutation C / G at the 646th base of the sequences represented by the SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 in the sequence table, and the base mutation causes the AluI-RFLP polymorphism. The invention also discloses a preparation method of the genetic marker, and an application of the genetic marker in the pig litter size marker-assisted selection.

Description

technical field [0001] The invention relates to the technical field of preparation of pig genetic markers, in particular to a porcine catenin α-like 1 CTNNAL1 gene as a genetic marker for pig litter size traits and its application, which includes porcine cadherin-associated protein α-like 1 (catenin (cadherin-associated protein), alpha -like 1, CTNNAL1) gene mutation site detection method and application. Background technique [0002] The litter size trait of pigs is a limited trait with low heritability, the heritability of the trait is only 0.10, and the genetic progress of conventional selection is limited. In recent years, molecular marker-assisted selection has provided new opportunities for genetic improvement of litter size traits. Molecular marker screening mainly includes candidate gene method and genome scanning method. The earliest pig litter size trait gene or marker isolated by the candidate gene method is the estrogen receptor gene (Estrogen receptor, ESR). ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/11C12Q1/68
Inventor李凤娥孙晓杰梅书棋陶虎彭先文苏丽娜蒋思文邓昌彦熊远著
OwnerHUAZHONG AGRI UNIV