DNA electrochemical sensor based on self-enhanced amplified signal of target DNA repeats

A DNA repetition and signal amplification technology, applied in the field of biosensing, can solve the problems of weak current signal, inability to catalyze TMB oxidation, and inability to form, so as to achieve the effect of improving sensitivity

Inactive Publication Date: 2015-11-18
福州市第二医院 +1
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the measured sequence and the probe cannot hybridize, the "sandwich" structure cannot be formed, that is, no enzyme is bound to the sensor, so the oxidation of TMB cannot be catalyzed, and the current signal generated is very weak

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA electrochemical sensor based on self-enhanced amplified signal of target DNA repeats
  • DNA electrochemical sensor based on self-enhanced amplified signal of target DNA repeats
  • DNA electrochemical sensor based on self-enhanced amplified signal of target DNA repeats

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] The preparation steps of the DNA electrochemical sensor based on the self-enhanced amplified electrical signal of the gene repeat sequence are as follows:

[0048] (1) Gold electrode in Piranha solution (30wt% H 2 o 2 Concentrated H with a concentration of 98wt% 2 SO 4 , mixed at a volume ratio of 1:3) at room temperature for 5 minutes, ultrasonically cleaned twice with deionized water, each time for 5 minutes, and then washed with 0.3 μm and 0.05 μm Al 2 o 3 and double-distilled water to polish to a mirror surface, followed by ultrasonic cleaning with ethanol and double-distilled water. Place the sonicated electrode at 0.5MH 2 SO 4 In the 0 ~ 1.6V potential range, cyclic voltammetry scan to stability, wash with double distilled water, N 2 Blow dry for later use;

[0049] (2) Immerse the bare gold electrode treated in step (1) in 0.1wt% BSA solution, assemble at room temperature for 15 minutes, wash with double distilled water, dry with nitrogen, take 4 μl captu...

Embodiment 2

[0051] The detection steps of the target DNA by the DNA electrochemical sensor based on the self-enhanced amplified electrical signal of the gene repeat sequence are as follows:

[0052] (1) Mix the signal probe DNA (5'-GTTTCCGTCCCTCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3') (oligonucleotide, synthesized by Baosheng Bioengineering Co., Ltd.) with the target DNA containing a repetitive sequence (5'-ACGGAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3') In the hybridization buffer solution (by 10mmol / LNa 2 HPO 4 -NaH 2 PO 4 And 1mol / LNaCl preparation, and with H 3 PO 4 and NaOH to adjust the pH to 7.40, and the experimental water is double distilled water) to prepare a hybridization solution.

[0053] (2) The capture probe DNA immobilized on the electrode surface obtained in Example 1 (5'-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT 10 -(CH 2 ) 6 -SH-3') and the hybridization solution obtained in step (1) were hybridized in a 44°C water bath for 60 minutes to...

Embodiment 3

[0057] The detection steps of the target DNA by the DNA electrochemical sensor based on the self-enhanced amplified electrical signal of the gene repeat sequence are as follows:

[0058] (1) Mix the signal probe DNA (5'-GTTTCCGTCCCTCTCTCGGGGTTTTGGGTCTGACGAC-Biotin-3') (50nmol / L oligonucleotide, synthesized by Baosheng Bioengineering Co., Ltd.) with the target DNA (5nmol / L, 5'-ACGGAAAACCTTCAGCACCACCATCATCCGGCGCCTCAGCTCAGCATGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAACCCTTCGACGCCGGATTCGTGATCTCTTCCCGCGGATAGGTCGTCAGACCCAAAACCCCGAGAGGGGACGGAAAC-3') in hybridization buffer solution (by 10mmol / LNa 2 HPO 4 -NaH 2 PO 4 And 1mol / LNaCl preparation, and with H 3 PO 4 and NaOH to adjust the pH to 7.40, and the experimental water is double distilled water) to prepare a hybridization solution.

[0059] (2) The capture probe DNA immobilized on the electrode surface obtained in Example 1 (5'-CCGGATGATGGTGGTGCTGAAGGTTTCCGTT 10 -(CH 2 ) 6 -SH-3') and the hybridization solution obtained in step (1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a DNA electrochemical sensor based on target DNA repetitive sequence self enhancement and amplification signal. A signal probe is designed by a repetitive sequence clip of a detected target chain, thus, the volume of the signal probes combined with the target sequence is increased, and a compound is formed, when a capture probe on electrode surface is hybridized with the target sequence, the amplified signal probe is combined with the electrode surface, under the affinity function between the biotin treated by end labeling of the signal probe and the avidin modified on the horseradish peroxidase, multiple enzymes are combined with a 'sandwich' structure, finally, under the efficient catalytic action of the enzymes, H2O2 is catalyzed to oxidize the TMB, the oxidative product generates an amplified reduction current signal on the electrode, and the concentration of the target DNA is judged according to the magnitude of the current signal. In the experiment, based on the characteristics of self enhancement and amplification signal of the target chain of the repetitive sequence, the target chain with two sections of repetitive sequences is detected, and the method is high in sensitivity.

Description

technical field [0001] The invention relates to a DNA electrochemical sensor based on a target DNA repeat sequence self-enhanced amplified signal, a preparation method thereof and a rapid detection of Mycobacterium tuberculosis, belonging to the technical field of biosensing. Background technique [0002] At present, DNA electrochemical sensors constructed by the combination of electrochemical and enzyme-catalyzed technologies have received extensive attention and have been applied to the detection of genes related to diseases such as tumors. The preparation method of the DNA electrochemical sensor constructed by the protein-controlled assembly interface has good repeatability. The principle is to construct a protein-controlled assembly interface on the surface of the gold electrode, so that a layer of spherical BSA molecular layer is assembled on the surface of the electrode. On these spherical The unoccupied gold sites are exposed between the molecules, and then the probes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N27/26
Inventor洪国粦刘银环陈伟林新华章涛
Owner福州市第二医院