Application of phic31 recombinase system and piggybac transposon, silkworm site-directed transgenic system and preparation method thereof
A transgenic and recombinase technology, applied in the biological field, can solve problems such as the establishment of a site-specific integration technology system, and achieve the effect of high-efficiency expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Construction of silkworm transgenic recombinant vector pBac{3×P3-DsRed; attP / attP}
[0040] According to the current silkworm requirements for preparing transgenic silkworms based on piggyBac transposable vectors, the silkworm transgenic recombinant vector pBac{3×P3-DsRed; attP / attP} was constructed ( figure 1 A). The specific steps are as follows: Synthesis of attP1-SpeI / XhoI-F: 5'- ctagt ccccaactggggtaacctttgagttctctcagttgggggg c -3' (SEQ ID NO.1), attP1-SpeI / XhoI-R5'- tcgag cccccaactgagagaactcaaaggttaccccagttgggg a -3' (SEQ ID NO. 2), attP2-SphI / BglII-F:5'-ccccaactggggtaacctttgagttctctcagttgggggg a -3' (SEQ ID NO.3) and attP2-SphI / BglII-R: 5'- gatct cccccaactgagagaactcaaaggttaccccagttgggg catg -3' (SEQ ID NO.4) four nucleotide sequences, the underline indicates the cohesive end of the restriction site. Pre-denature the synthesized SEQ ID NO.1 and SEQ ID NO.2 at a temperature of 95°C for 5 minutes, then lower the temperature by 1°C every 60s, keep it at ...
Embodiment 2
[0058] 1. Establishment of transgenic target lines
[0059] The diapause silkworm strain Dazao was used as the raw material, and the parental silkworm eggs were treated with low-temperature acceleration at 16°C to relieve the diapause of the offspring silkworm eggs; 10-15 nL of the recombinant vector pBac{3×P3 The mixture of -DsRed; attP / attP} and the helper plasmid pHA3PIG was injected into 294 G0 silkworm eggs released from diapause, sealed with non-toxic glue and placed in an environment at 25°C and a relative humidity of 85% to accelerate hatching , hatched to obtain 80 G0 generation silkworms, and then raised the silkworms with mulberry leaves until they turned into moths, and obtained 74 G0 generation silkworms, and obtained 40 circles of G1 generation silkworm eggs by backcrossing the obtained silkworm moths. Observe with a motorized macroscopic fluorescent microscope, and then screen the moth circles that emit red fluorescence. The results are as follows: Figure 4 s...
Embodiment 3
[0063] Dazao, a diapause silkworm strain, was used as the original material. Parental silkworm eggs were treated with low-temperature acceleration at 16°C to relieve diapause of offspring silkworm eggs. 10-15nL of the recombinant vector pBac{3×P3 with a total concentration of 400ng / μL -DsRed; attB / attB} and the helper plasmid pHA3PIG were injected into 108 G0 silkworm eggs released from diapause, sealed with non-toxic glue and placed in a high-humidity environment at 25°C and a relative humidity of 85%. Green hatching, the hatched 10 G0 generation silkworm mulberry leaves were collected and raised to moths, and 8 G0 generation silkworm moths were obtained. A total of 50 circles of G1 generation silkworm eggs were obtained through backcrossing. Motorized macroscopic fluorescence microscope observation, the results are as follows Figure 10 shown. Through observation and screening, one moth circle with red fluorescence was obtained, and a positive transgenic silkworm with red ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com