Application of phic31 recombinase system and piggybac transposon, silkworm site-directed transgenic system and preparation method thereof

A transgenic and recombinase technology, applied in the biological field, can solve problems such as the establishment of a site-specific integration technology system, and achieve the effect of high-efficiency expression

Inactive Publication Date: 2014-10-29
SOUTHWEST UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the site-specific integration technology system based on the phiC31 / att system has not been established at the silkworm individual level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of phic31 recombinase system and piggybac transposon, silkworm site-directed transgenic system and preparation method thereof
  • Application of phic31 recombinase system and piggybac transposon, silkworm site-directed transgenic system and preparation method thereof
  • Application of phic31 recombinase system and piggybac transposon, silkworm site-directed transgenic system and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Construction of silkworm transgenic recombinant vector pBac{3×P3-DsRed; attP / attP}

[0040] According to the current silkworm requirements for preparing transgenic silkworms based on piggyBac transposable vectors, the silkworm transgenic recombinant vector pBac{3×P3-DsRed; attP / attP} was constructed ( figure 1 A). The specific steps are as follows: Synthesis of attP1-SpeI / XhoI-F: 5'- ctagt ccccaactggggtaacctttgagttctctcagttgggggg c -3' (SEQ ID NO.1), attP1-SpeI / XhoI-R5'- tcgag cccccaactgagagaactcaaaggttaccccagttgggg a -3' (SEQ ID NO. 2), attP2-SphI / BglII-F:5'-ccccaactggggtaacctttgagttctctcagttgggggg a -3' (SEQ ID NO.3) and attP2-SphI / BglII-R: 5'- gatct cccccaactgagagaactcaaaggttaccccagttgggg catg -3' (SEQ ID NO.4) four nucleotide sequences, the underline indicates the cohesive end of the restriction site. Pre-denature the synthesized SEQ ID NO.1 and SEQ ID NO.2 at a temperature of 95°C for 5 minutes, then lower the temperature by 1°C every 60s, keep it at ...

Embodiment 2

[0058] 1. Establishment of transgenic target lines

[0059] The diapause silkworm strain Dazao was used as the raw material, and the parental silkworm eggs were treated with low-temperature acceleration at 16°C to relieve the diapause of the offspring silkworm eggs; 10-15 nL of the recombinant vector pBac{3×P3 The mixture of -DsRed; attP / attP} and the helper plasmid pHA3PIG was injected into 294 G0 silkworm eggs released from diapause, sealed with non-toxic glue and placed in an environment at 25°C and a relative humidity of 85% to accelerate hatching , hatched to obtain 80 G0 generation silkworms, and then raised the silkworms with mulberry leaves until they turned into moths, and obtained 74 G0 generation silkworms, and obtained 40 circles of G1 generation silkworm eggs by backcrossing the obtained silkworm moths. Observe with a motorized macroscopic fluorescent microscope, and then screen the moth circles that emit red fluorescence. The results are as follows: Figure 4 s...

Embodiment 3

[0063] Dazao, a diapause silkworm strain, was used as the original material. Parental silkworm eggs were treated with low-temperature acceleration at 16°C to relieve diapause of offspring silkworm eggs. 10-15nL of the recombinant vector pBac{3×P3 with a total concentration of 400ng / μL -DsRed; attB / attB} and the helper plasmid pHA3PIG were injected into 108 G0 silkworm eggs released from diapause, sealed with non-toxic glue and placed in a high-humidity environment at 25°C and a relative humidity of 85%. Green hatching, the hatched 10 G0 generation silkworm mulberry leaves were collected and raised to moths, and 8 G0 generation silkworm moths were obtained. A total of 50 circles of G1 generation silkworm eggs were obtained through backcrossing. Motorized macroscopic fluorescence microscope observation, the results are as follows Figure 10 shown. Through observation and screening, one moth circle with red fluorescence was obtained, and a positive transgenic silkworm with red ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a phiC31 recombinase system and a piggyBac transposon and a fixed point transgenetic system of silkworm and a preparation method of the fixed point transgenetic system. According to the invention, the phiC31 recombinase system and the transgenic technology for mediating the silkworm to transform by the piggyBac transposon are combined; first, two attB sites or attP sites which are arranged in the same direction are connected into a piggyBac transposon carrier; the carrier in transformed into silkworm; then, single copy transgenetic silkwork is screened to be used as a target system; then, the target system is transformed by using the phiC31 recombinase and a carrier, wherein target gene expression frames are anchored at the two ends of the carrier by the attB sites or attP sites which are arranged in the same direction; and thus the target gene expression frames are transformed to the place between fixed points, namely the two attB sites or attP sites of the piggyBac transposon carrier, thereby realizing the purpose of fixed point transgene of silkwork. The method is simple to operate and provides a powerful tool for genetic function research for silkworm.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of a phiC31 recombinase system and piggyBac transposon in the preparation of silkworm site-specific transgenes, and also relates to a silkworm site-specific transgene system containing phiC31 recombinase system and piggyBac transposon and the use of the system Method for preparing site-specific transgenic silkworm. Background technique [0002] China is a big silk country and the birthplace of the ancient Silk Road. The silkworm is one of the most successful and longest economic insects utilized by humans in the world at present. The domestication and breeding of the silkworm have a history of about 5,000 years. As a very important model organism of Lepidoptera, silkworm has great value and significance for in-depth research. With the completion of the silkworm genome frame map, fine map and genetic mutation map, it marks that silkworm genome research ha...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/00C12N15/11C12N15/63C12N15/52
Inventor赵爱春龙定沛陆威健郭庆向仲怀
OwnerSOUTHWEST UNIV