Recombinant virus expressing PCV2 codon optimized ORF1 and ORF2 tandem gene
A technology of codon optimization and recombinant virus, which is applied in the fields of genetic engineering vaccines and bioengineering, to achieve the effects of increased expression, good immunogenicity and protection, and high safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0046] 1. Construction of recombinant baculoviruses expressing foreign genes
[0047] 1) Optimization and synthesis of PCV2 ORF2 gene
[0048] By comparing and analyzing all the sequences of PCV2 in GenBank, the consensus sequences of PCV2 ORF1 and ORF2 expressed amino acids were obtained, and the PCV2 ORF1 and ORF2 genomes were transformed into partial codons in insect cells through codon optimization, and according to specific conditions (GC content, Avoid repeated sequences, etc.) to make appropriate adjustments, if the codon with the highest frequency cannot be used, select the codon with the second highest frequency. And optimize and transform the rare codons relative to baculovirus. Artificially synthesized codon-optimized PCV2 ORF1 and ORF2 tandem genes, the gene is named YHsfORF1-2, and its sequence is (SEQ.ID.NO.1):
[0049] 1 ATGCCCTCAAAGAAGAACGGTAGAAGCGGACCACAGCCACACAAGAGATG
[0050] 51 GGTTTTTCACACTCAAACAACCCCTCAGAAGACGAGCGTAAGAAGATCAGAG
[0051] 101 AGTTGCCAAT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap