Soybean chalcone reductase gene CHR4 and application

A technology of CHR4 and reductase, which is applied in the field of biosynthesis of plant secondary metabolite daidzein, and can solve problems related to unclear synthesis ability

Inactive Publication Date: 2014-05-07
JILIN AGRICULTURAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is only one soybean reductase gene CHR1 whose function can be confirmed in GENEBANK in the United States
So far, there is no conclusion about the type and quantity of chalcone reductase (CHR) in soybean, and it is not clear that different types of chalcone reductase (CHR) are related to the synthesis ability of daidzein in plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean chalcone reductase gene CHR4 and application
  • Soybean chalcone reductase gene CHR4 and application
  • Soybean chalcone reductase gene CHR4 and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Cloning of Soybean Chalcone Reductase Gene CHR4

[0021] The soybean variety "Jinong 17" (seeds provided by the Biotechnology Center of Jilin Agricultural University) was selected and planted in the field. When the plants grew to the flowering stage, the leaf tissue was selected, and the total RNA was extracted using the kit RNAiso Plus, and followed by the American Fermentas company. Reverse transcription was performed according to the instructions of the reverse transcription kit, and the first strand of cDNA was synthesized. Primers P1 and P2 were designed according to an incomplete gene fragment of unknown function (No. TC203399) contained in the soybean EST library of the National Center for Biological Information (NCBI). RT-PCR was used to amplify specific fragments using cDNA as a template. Then, the RACE kit from TAKARA Company was used to clone the 3' end fragment and the 5' end fragment of the target gene respectively. After the sequences at both...

Embodiment 2

[0027] Example 2 Construction of Plant Expression Vector PBI121-CHR4 Gene

[0028]The gene sequence of the open reading frame was predicted by the special analysis software on the website of the National Center for Biological Information (NCBI), and the predicted result was a fragment with a length of 966bp, and the open reading frame was at 205-1170bp. According to the cDNA sequence of soybean chalcone reductase CHR4 gene, design primers with restriction enzyme sites and amplify the complete coding reading frame, add XbaⅠ enzyme site in the upstream, add BamHI enzyme site in the downstream, and add primers in the upstream Primer: GGG TCTAGA ATGTCTGCAACAAACGTCCC, downstream primer: TTT GGATCC TTGGTGAGTGACCAATCAAAT, PCR amplification was performed using the cDNA obtained in Example 1 as a template, and the amplified fragment of CHR4 with upstream and downstream restriction sites was connected to the PMD-18T vector . Then digest the plasmid vector of the CHR4 gene with XbaⅠ / B...

Embodiment 3

[0030] Example 3 Cultivation of Transformed CHR4 Gene Tobacco

[0031] Then the recombinant expression vector pBI121-CHR4 was transformed into competent Agrobacterium DH105 by heat shock method. Tobacco explants were prepared for transformation with Agrobacterium. Select tobacco seeds with full grains, sterilize them with 70% alcohol and 5% sodium hypochlorite solution, wash them with sterile deionized water, inoculate them on the tobacco germination medium, and cultivate them in a bright place for 15 days; transform Agrobacterium in YEP The liquid medium was cultured with shaking at 28°C until the OD600 value was 0.6-0.8, and the bacteria were collected by centrifugation and resuspended with MS liquid medium. Cut off the sprouted tobacco 1cm 2 Leaves of the same size and punched a number of holes, put them into the MS medium containing transformed Agrobacterium and suspended them for 8 minutes, then placed the leaves on the common medium of tobacco, and cultivated them in...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a soybean chalcone reductase gene CHR4 and an application. The gene CHR4 is a new chalcone reductase gene in soybean; experiments prove that an expression product of the gene can catalyze the synthesis of isoliquiritigenin; the CHR4 comes from soybean and has an optimizing codon suitable for dicotyledons such as soybean and the like; and a genetic engineering receptor is mainly suitable for the dicotyledons such as soybean, tobacco, cotton and the like, and is also suitable for monocotyledons such as rice, wheat, corn and the like. The gene CHR4 can be transferred into a plant as a target gene and is used for catalyzing the synthesis of a precursor substance isoliquiritigenin required for the daidzein biosynthesis so as to improve the content of daidzein in the plant; and moreover, as a plant defensin, the daidzein can improve the plant disease resistance, has an effect on preventing and treating multiple diseases of human bodies, and also is a good healthcare product.

Description

technical field [0001] The invention relates to soybean chalcone reductase gene CHR4 and its application in genetic engineering. The invention belongs to the field of genetic engineering, and specifically relates to the biosynthesis of plant secondary metabolite daidzein. technical background [0002] Rapid amplification of complementary DNA ends (RACE technology) is a molecular biology technique that completely separates and clones the 3' and 5' ends of incomplete genes. So far, with the rapid development of library construction technology and high-throughput sequencing technology, more and more nucleic acid fragments have been isolated and sequenced. However, the problem is that the integrity and functionality of nucleic acid fragments still require a lot of experimental work to determine, and continue to explore and discover genetic resources that are beneficial to human practical use. [0003] Daidzein is one of the main components of soybean isoflavones, accounting fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/53C12N15/84A01H5/00
Inventor王丕武张卓曲静付永平刘思言张超魏洪波吴楠李丹
OwnerJILIN AGRICULTURAL UNIV