Soybean chalcone reductase gene CHR4 and application
A technology of CHR4 and reductase, which is applied in the field of biosynthesis of plant secondary metabolite daidzein, and can solve problems related to unclear synthesis ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 Cloning of Soybean Chalcone Reductase Gene CHR4
[0021] The soybean variety "Jinong 17" (seeds provided by the Biotechnology Center of Jilin Agricultural University) was selected and planted in the field. When the plants grew to the flowering stage, the leaf tissue was selected, and the total RNA was extracted using the kit RNAiso Plus, and followed by the American Fermentas company. Reverse transcription was performed according to the instructions of the reverse transcription kit, and the first strand of cDNA was synthesized. Primers P1 and P2 were designed according to an incomplete gene fragment of unknown function (No. TC203399) contained in the soybean EST library of the National Center for Biological Information (NCBI). RT-PCR was used to amplify specific fragments using cDNA as a template. Then, the RACE kit from TAKARA Company was used to clone the 3' end fragment and the 5' end fragment of the target gene respectively. After the sequences at both...
Embodiment 2
[0027] Example 2 Construction of Plant Expression Vector PBI121-CHR4 Gene
[0028]The gene sequence of the open reading frame was predicted by the special analysis software on the website of the National Center for Biological Information (NCBI), and the predicted result was a fragment with a length of 966bp, and the open reading frame was at 205-1170bp. According to the cDNA sequence of soybean chalcone reductase CHR4 gene, design primers with restriction enzyme sites and amplify the complete coding reading frame, add XbaⅠ enzyme site in the upstream, add BamHI enzyme site in the downstream, and add primers in the upstream Primer: GGG TCTAGA ATGTCTGCAACAAACGTCCC, downstream primer: TTT GGATCC TTGGTGAGTGACCAATCAAAT, PCR amplification was performed using the cDNA obtained in Example 1 as a template, and the amplified fragment of CHR4 with upstream and downstream restriction sites was connected to the PMD-18T vector . Then digest the plasmid vector of the CHR4 gene with XbaⅠ / B...
Embodiment 3
[0030] Example 3 Cultivation of Transformed CHR4 Gene Tobacco
[0031] Then the recombinant expression vector pBI121-CHR4 was transformed into competent Agrobacterium DH105 by heat shock method. Tobacco explants were prepared for transformation with Agrobacterium. Select tobacco seeds with full grains, sterilize them with 70% alcohol and 5% sodium hypochlorite solution, wash them with sterile deionized water, inoculate them on the tobacco germination medium, and cultivate them in a bright place for 15 days; transform Agrobacterium in YEP The liquid medium was cultured with shaking at 28°C until the OD600 value was 0.6-0.8, and the bacteria were collected by centrifugation and resuspended with MS liquid medium. Cut off the sprouted tobacco 1cm 2 Leaves of the same size and punched a number of holes, put them into the MS medium containing transformed Agrobacterium and suspended them for 8 minutes, then placed the leaves on the common medium of tobacco, and cultivated them in...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 