Construction method for recombinant strain producing L-glutamic oxidase and applications of the recombinant strain
A technology of glutamate oxidase and recombinant strains, applied in the fields of genetic engineering and enzymology, and can solve problems such as inactivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0020] 1. Construction of recombinant strains:
[0021] 1) Use primer 1: 5'CATGCCATGGCAATGACTGAAGATCACGCGG3' and primer 2: 5'CCCAAGCTTGCGCTGTGTGGATCTCCAAG3' to perform PCR amplification on the gene group (NCBI sequence number: EFE71695.1) from Streptomyces ghanaensis ATCC14672: add LA taq enzyme to the system, 95°C Pretreatment for 9min, melting at 95°C for 30s, annealing at 65°C for 30s, extension at 72°C for 2.2min, 30 cycles;
[0022] 2) Digest the target gene and expression vectors pET20b and pET28a with restriction endonucleases Nco I and HindIII at 37°C for 2 hours;
[0023] 3) Use T4 ligase to ligate the digested target gene and plasmids pET20b and pET28a at 16°C for 10 h, transfer them into the expression strain E.coli BL21 by chemical transformation, and smear them on LB plates containing ampicillin and kanapenicillin Medium culture for 12h;
[0024] 4) Perform PCR and enzyme digestion verification on the colonies grown on the plate, perform sequencing verification ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com