Construction method for recombinant strain producing L-glutamic oxidase and applications of the recombinant strain

A technology of glutamate oxidase and recombinant strains, applied in the fields of genetic engineering and enzymology, and can solve problems such as inactivity

Inactive Publication Date: 2013-11-13
JIANGNAN UNIV
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are also reports on the construction of glutamate oxidase recombinant strains, mainly from the gene of Streptomyces sp.X-119-6, which produce inclusion bodies or premise, which are inactive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for recombinant strain producing L-glutamic oxidase and applications of the recombinant strain
  • Construction method for recombinant strain producing L-glutamic oxidase and applications of the recombinant strain
  • Construction method for recombinant strain producing L-glutamic oxidase and applications of the recombinant strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] 1. Construction of recombinant strains:

[0021] 1) Use primer 1: 5'CATGCCATGGCAATGACTGAAGATCACGCGG3' and primer 2: 5'CCCAAGCTTGCGCTGTGTGGATCTCCAAG3' to perform PCR amplification on the gene group (NCBI sequence number: EFE71695.1) from Streptomyces ghanaensis ATCC14672: add LA taq enzyme to the system, 95°C Pretreatment for 9min, melting at 95°C for 30s, annealing at 65°C for 30s, extension at 72°C for 2.2min, 30 cycles;

[0022] 2) Digest the target gene and expression vectors pET20b and pET28a with restriction endonucleases Nco I and HindIII at 37°C for 2 hours;

[0023] 3) Use T4 ligase to ligate the digested target gene and plasmids pET20b and pET28a at 16°C for 10 h, transfer them into the expression strain E.coli BL21 by chemical transformation, and smear them on LB plates containing ampicillin and kanapenicillin Medium culture for 12h;

[0024] 4) Perform PCR and enzyme digestion verification on the colonies grown on the plate, perform sequencing verification ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method for a recombinant strain producing L-glutamic oxidase and applications of the recombinant strain, and belongs to the fields of genetic engineering and enzyme products. Glutamic oxidase inclusion bodies produced by recombination are subjected to protein denaturation, renaturation and concentration to allow that 30% of the protein inclusion bodies regain activity. Researches on enzymatic properties of a recombinase show that the optimum pH of the recombinase is 8.5, the optimum temperature of the recombinase is 35 DEG C, Mn<2+> can increase the enzyme specific activity by over 20%, and exogenous addition of FAD has no influence on the enzyme activity. By combination of enzymatic characteristics, 8.3 g / L of alpha-ketoglutaric acid can be produced by adding the recombinase into a buffer solution that contains 20 g / L of sodium glutamate and has a pH of 8.5, and converting at 35 DEG C for 12 h.

Description

technical field [0001] The invention relates to a construction method and application of a recombinant bacterial strain producing L-glutamic acid oxidase in the fields of genetic engineering and enzymology. Background technique [0002] L-glutamic acid oxidase is mainly found in Streptomyces, Streptomyces platensis NTU3304, Streptomyces sp.X-119-6, Streptomyces sp.Z-11-6, Streptomyces endus and Streptomyces ghanaensis have been reported to produce L - Glutamate oxidase, glutamate oxidase can oxidize 1moL L-glutamate requires 1moL O 2 and 1moL and H 2 O, generate 1moL α-ketoglutaric acid, 1moL NH 3 and 1moL H 2 o 2 . At present, research at home and abroad is mainly focused on using this reaction to determine the content of glutamic acid in food and fermentation processes. Recent studies have found that this enzyme can be used to determine the content of alanine aminotransferase and aspartate aminotransferase in biological fluids, so as to make early detection of heart a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/76C12N9/06C12P7/46C12R1/465
Inventor刘立明牛盼清董晓翔
OwnerJIANGNAN UNIV