Recombined porcine interferon Gamma, coding gene thereof and expressing method

A porcine interferon and gene technology, applied in the directions of interferon, chemical instruments and methods, botanical equipment and methods, etc., can solve the problems of precipitation, influence on yield, imperfect processing and modification system, etc.

Active Publication Date: 2013-04-24
GENSUN INST OF BIOMEDICINE
View PDF2 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still many insurmountable shortcomings in the prokaryotic expression system: for example, the expression time and expression level cannot be regulated, the expression of foreign proteins is toxic to the host cell, and the purification of the product is difficult; in addition, due to the prokaryotic expression system translation The post-processing modification system is not perfect, and the products are mostly produced in the form of inclusion bodies with low biological activity
If the renaturation conditions are not suitable, there will be a mismatch of disulfide bonds in the molecule, and covalent or hydrophobic bonds between molecules will form aggregates, which will reduce the specific activity of the recombinant protein, resulting in unqualified product quality and easy precipitation. , affecting the yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombined porcine interferon Gamma, coding gene thereof and expressing method
  • Recombined porcine interferon Gamma, coding gene thereof and expressing method
  • Recombined porcine interferon Gamma, coding gene thereof and expressing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Recombinant porcine interferon gamma gene optimization design

[0060] 1. Codon optimization

[0061] There are 64 genetic codes, but most organisms tend to use a subset of these. Those that are most frequently used are called optimal codons, and those that are not frequently used are called rare or low-usage codons. Virtually every organism commonly used for protein expression or production (including E. coli, yeast, mammalian cells, plant cells, and insect cells) exhibits some degree of difference or bias in codon usage. The expression efficiency of genes containing optimal codons in E. coli, yeast and Drosophila was significantly higher than that of genes containing low utilization codons. Therefore, in the heterologous expression system, the codon bias largely affects the expression of recombinant proteins. Gene synthesis using preferred codons and avoiding rare codons is called codon optimization. The optimization process fully takes into account va...

Embodiment 2

[0084] Embodiment 2: the expression plasmid construction of recombinant porcine interferon gamma gene

[0085] The fragment synthesized from the optimized recombinant porcine interferon gamma gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing KingScript Technology Co., Ltd.) to obtain a long-term preservation plasmid. is the pUC57-prIFNγ plasmid. Using the pUC57-prIFNγ plasmid as a template, the upstream and downstream primers were respectively introduced into NdeI and XhoI restriction sites for PCR amplification. The sequences of the primers used are as follows:

[0086] Upstream primers:

[0087] P1: GGGAATTCCATATGCAGGCCCCGTTTCTTCAAGG

[0088] Downstream primers:

[0089] P2: CCGCTCGAGTCATTTCGATGCGCGTTGGCC

[0090] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol / L, and 1 μL of dNTP at a concentration of 10 mmol / L was added. The DNA polymerase used was Phusion Hig...

Embodiment 3

[0092] Example 3 Expression and Identification of Recombinant Porcine Interferon γ in Escherichia coli

[0093] Specific steps are as follows:

[0094] 1. The pET21b-prIFNγ plasmid with correct sequencing alignment in Example 2 was transformed into a competent strain of Escherichia coli BL21 (DE3) (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), and cultured overnight on an ampicillin plate at 37°C.

[0095] 2. On the second day, pick 1-4 recombinant colonies containing the pET21b-prIFNγ plasmid, insert them into LB medium containing 100 μg / mL ampicillin, and culture them overnight at 37°C.

[0096] 3. Take 50 μL of the overnight culture and insert it into 5 mL of LB induction medium containing 100 μg / mL ampicillin, and culture at 37°C with shaking.

[0097] 4. The OD600 value of the bacterial solution was measured every 1 h after inoculation, and when the OD600=1.0, the expression was induced with 1 mmol / L IPTG (purchased from Amresco). At the same t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombined porcine interferon Gamma, a coding gene thereof, and an expressing, purifying and inclusion body refolding method, and belongs to the field of biological gene engineering. The recombined porcine interferon Gamma serves as a non-specific broad-spectrum anti-viral biological preparation, and has a wide medicinal prospect in the field of veterinary medicines; but as most of gene engineering veterinary medicines, the porcine interferon Gamma has the problems of underproduction, high prices, non-uniform quality and the like. According to the recombined porcine interferon Gamma, the coding gene thereof and the expressing method, an escherichia coli expression system is used for performing heterologous expression for the recombined porcine interferon Gamma subjected to codon optimization. Besides, aiming at the problem that the porcine interferon Gamma in a prokaryotic expression system is usually expressed in a manner of an inclusion body, the invention further provides the purifying and refolding method for the inclusion body of the recombined porcine interferon Gamma, so that the prepared recombined porcine interferon Gamma has high activity and meets a standard for industrialized production.

Description

technical field [0001] The invention belongs to the field of bioengineering genes, and relates to a recombinant porcine interferon gamma and its coding gene, as well as its expression, purification and inclusion body renaturation methods. Background technique [0002] Interferon (Interferon, IFN) is a group of active proteins (mainly glycoproteins) with multiple functions, and is a cytokine produced by monocytes and lymphocytes. They have broad-spectrum anti-virus, affect cell growth, differentiation, regulation of immune function and other biological activities on the same kind of cells. According to the source of IFN, that is, animal species, cell type, the nature of the inducer and the induction conditions, it can be divided into three types: α, β, and γ. Among them, interferon-γ (interferon, IFN-γ) is known as immune interferon and is synthesized by T cells and NK cells. Its biological effects include antiviral activity, anti-tumor cell proliferation, induction of MHC c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/57C12N15/23C12N15/63C12N1/21C12P21/02C07K1/14A61K38/21A61P31/14A61P31/16C12R1/19
Inventor马永王安良章成昌徐春林陈晨王耀方
OwnerGENSUN INST OF BIOMEDICINE