Molecular marker closely linked with major gene locus of grain weight of wheatear as well as acquiring method and application of molecular marker
A technology of molecular markers and main effect genes, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., to achieve the effect of improving selection efficiency and quality, fast and accurate screening, and accelerating the selection process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] A molecular marker closely linked to the main effect gene locus of wheat panicle weight,
[0036] labeled primers Xcfd80.2 ,
[0037] The left end primer sequence ATAGGGGTTTTGAATCACTCC (as described in SEQ ID NO: 1),
[0038] Right end primer sequence TTGGATTTGCAGAGCCTTCT (as described in SEQ ID NO: 2)
[0039] and molecular markers Xbarc146.1 primers,
[0040] The left end primer sequence AAGGCGATGCTGCAGCTAAT (as described in SEQ ID NO:3),
[0041] Right end primer sequence GGCAATATGGAAACTGGAGAGAAAT (as described in SEQ ID NO:4)
[0042] The DNA of wheat variety Jing 411 was amplified by PCR respectively. The PCR amplification system was 20 μl, including: 1.0 μl each of the left and right primers (10 μmol / L), 10×Buffer 2.0 μl, Mg 2+ (25 mmol / L) 1.2 μl, Taq enzyme (5 U / μl) 0.2 μl, dNTP (2.5 mmol / L) 0.6 μl, DNA (30 ng / μl) 2.0 μl, and ddH for the rest 2 O supplementation; PCR amplification program: 94°C pre-denaturation for 7 min; 94°C denaturation for 30 s, 60 / 51...
Embodiment 2
[0056] Main effect gene locus provided by the invention and wheat ear grain weight QKws.cas-6A Application of tightly linked molecular markers in 10 derived lines of wheat variety Jing 411 and wheat variety Xiaoyan 54.
[0057] Using Xiaoyan 54 as the female parent and Jing 411 as the male parent, the F 7 Recombinant inbred line populations (RIL populations). labeled primers Xcfd80.2 and Xbarc146.1 Jing 411, Xiaoyan 54 and 10 derivative lines were analyzed. The specific steps are as follows:
[0058] (1) Wheat varieties Jing 411, Xiaoyan 54 and 10 derivative lines were planted in the field, and the leaves of the plants of each line were separated and extracted by the SDS method;
[0059] The derivative strain of the wheat variety Jing 411 refers to a strain obtained by using Xiaoyan 54 as the female parent and Jing 411 as the male parent through the single-seed propagation method;
[0060] (2) Using labeled primers Xcfd80.2 and Xbarc146.1 The obtained DNA was amplif...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap