Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi

A site-specific, fungal technology that can be used in genetic engineering, other methods of inserting foreign genetic material, stably introducing foreign DNA into chromosomes, etc., and can solve problems such as irreversible excision

Inactive Publication Date: 2014-02-05
NOVOZYMES AS
View PDF26 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In practice, however, excision is largely irreversible because the probability of intramolecular interactions where two recombination sites are closely connected is much higher than the probability of intramolecular interactions between disjoint sites
A corollary is that DNA molecules inserted into genomic recombination sites are easily excised

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
  • Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
  • Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 10

[0206] Plasmid pJaL504 is described in Example 10.

[0207] Plasmid pJaL504-delta-Bglll is described in Example 10.

[0208] Plasmid pJaL554 is described in Example 1 of patent WO2000 / 050567A1.

[0209] Plasmid pJaL574 is described in Example 10.

[0210] Plasmid pJaL835 is described in Example 10.

[0211] Plasmid pJaL955 is described in Example 10.

[0212] Plasmid pJaL1022 is described in Example 10.

[0213] Plasmid pJaL1025 is described in Example 10.

[0214] Plasmid pJaL1027 is described in Example 10.

[0215] Plasmid pJaL1029 is described in Example 10.

[0216] Plasmid pJaL1120 is described in Example 10.

[0217] Plasmid pJaL1123 is described in Example 10.

[0218] Plasmid pJaL1183 is described in Example 10.

[0219] Plasmid pJaL1194 is described in Example 10.

[0220] Plasmid pJaL1202 is described in Example 10.

[0221] Plasmid pToC65 is described in patent WO91 / 17243.

[0222] Plasmid pUC19: This construction is described in Vieira et al., 1982, Ge...

Embodiment 1

[0254] Example 1. Introduction at the neutral amylase I (NAI) locus of Aspergillus niger NN059095 FRT site

[0255] Construction of hygromycin B resistance gene expression plasmid pHUda966

[0256] Based on the nucleotide sequence information in GENBANK (ID#AB007770), the following primers Tef-F and Tef-R were designed to introduce EcoRI / SpeI and BamHI sites, respectively, to isolate the promoter region of Aspergillus oryzae tef1 (translation elongation factor 1 / Ptef1):

[0257] Tef-F (SEQ ID NO: 1): gaattcactagtggggttcaaatgcaaacaa

[0258] Tef-R (SEQ ID NO: 2): ggatcctggtgcgaactttgtagtt

[0259] A PCR reaction was performed using the primer pair Tef-F and Tef-R with the genomic DNA of Aspergillus oryzae strain BECh2 as a template. The reaction products were separated on 1.0% agarose gel, and the 0.7kb product band was excised from the gel. The 0.7 kb amplified DNA fragment was digested with BamHI and EcoRI and ligated into the Aspergillus expression cassette pHUda4...

Embodiment 2

[0289] Example 2. Introduction of an FRT site at the acid-stable amylase locus of Aspergillus niger NN059095 point

[0290] Construct the expression plasmid pHUda976 of Aspergillus nidulans acetamidase gene (amdS).

[0291] Based on the nucleotide sequence information in EMBL:AF348620, the following primers amdS-F and amdS-R were designed to introduce the BamHI and XhoI sites, respectively, to isolate the coding region of the amdS gene:

[0292] amdS-F (SEQ ID NO: 19): ggatccaccatgcctcaatcctgg

[0293] amdS-R (SEQ ID NO: 20): ctcgagctatggagtcaccacatttcccag

[0294] A PCR reaction was performed using the primer pair amdS-F and amdS-R with the genomic DNA of Aspergillus nidulans strain NRRL1092 as template. The reaction products were separated on a 1.0% agarose gel, and a 1.0 kb product band was excised from the gel. The 1.9 kb amplified DNA fragment was digested with BamHI and XhoI and ligated into the Aspergillus expression cassette pHUda440-Ptef-Tnia digested with Ba...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for the simultanoues integration of two or more copies of a polynucleotide of interest into the chromosome of a fungal host cell comprising at least two pairs of recognition sequences of a site-specific recombinase, each pair flanking a resident negative selection marker; transformation of the cell with a construct carrying a gene of interest also flanked by the recognition sequences to ensure double-crossover events after transient expression of the recombinase, followed by selection for excision of all negative selection markers from the cell.

Description

[0001] References to Sequence Listings [0002] This application contains a Sequence Listing in computer readable form. This computer readable form is incorporated herein by reference. technical field [0003] The present invention relates to a method for the simultaneous site-specific integration of multiple copies of a polynucleotide of interest into the genome of a fungal host cell using a transiently expressed recombinase together with a suitable resident selectable marker. Background technique [0004] A large number of naturally occurring organisms have been found to produce useful polypeptide products, such as enzymes, the large-scale production of which is desirable for research and commercial use. After the identification of such polypeptide products, efforts are often made to develop manufacturing methods with improved productivity. A widely used method based on recombinant DNA technology is to clone the gene encoding the product and insert the gene into a suita...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/80C12N15/90
CPCC12N15/80C12N15/902C12P21/02
Inventor宇田川裕晃
OwnerNOVOZYMES AS