Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of dna library and the method for constructing transcription activator-like effector nuclease plasmid

A DNA library and transcription activation technology, applied in the field of genetic engineering, can solve problems such as difficulty, cumbersome operation, complicated process flow, etc., and achieve the effect of avoiding damage and degradation, improving production process, and simple operation steps.

Active Publication Date: 2015-07-29
浙江煦顼技术有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But they all have their own defects, because the chemical synthesis of highly repetitive sequences of DNA to be synthesized is very difficult and the cost is very high; the two-step method requires two steps of connection, so the material cost, time cost, and sequencing cost are all high; the now public The only method that can be connected in one step can only connect up to 14 recognition modules, and the length of common recognition modules in nature is 12-23. The limitation not only affects the application of this method, but also is not conducive to the improvement of TALEN specificity, and because of the need for enzyme digestion, purification, and re-ligation, the operation is cumbersome, the process is complicated, and the DNA after enzyme digestion and purification is difficult to store, especially single-stranded DNA. tail easily degrades
[0006] In the past, some researchers connected TALEN with a single module, such as connecting 18 recognition modules. It is very difficult to connect 18 fragments in one reaction, and no one in the world has been able to achieve it; Can connect 14 identification modules

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of dna library and the method for constructing transcription activator-like effector nuclease plasmid
  • A kind of dna library and the method for constructing transcription activator-like effector nuclease plasmid
  • A kind of dna library and the method for constructing transcription activator-like effector nuclease plasmid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Connection between TALENs recognition modules and construction of recombinant vector

[0042] 1. Acquisition of 20 identification modules (modular)

[0043] (1) The synthesis recognizes 4 single bases A, T, C, G and 16 double bases AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, 20 identification modules for GT, GC, GG NI, NG, HD, NN, NI-NI, NI-NG, NI-HD, NI-NN, NG-NI, NG-NG, NG-HD, NG-NN, The sequences of HD-NI, HD-NG, HD-HD, HD-NN, NN-NI, NN-NG, NN-HD, and NN-NN are shown in Table 1, as shown in SEQ ID NO: 1-20, respectively.

[0044] Table 1

[0045]

[0046]

[0047]

[0048] 2. Make 172 plasmid libraries by adding restriction sites and linkers to the basic modules

[0049] (1) PCR amplification to add enzyme-cut recognition sequences and connection adapters

[0050] F1, R1; F2, R2; F3, R3; F4, R4; F5, R5; F6, R6; F7, R7; F8, R8; F9, R9 as primers, T vector containing 16 double modules as template Do PCR, a total of 16×9=144;

[0051] Us...

Embodiment 2

[0102] connect identifiable bases

[0103] Fragment 1: TALEN of CGCGCGCGCGCGCGCGCGCGT (SEQ ID NO: 47), Fragment 2 CCCACTCCCCATCCAGT (SEQ ID NO: 48).

[0104] (1) First select the required recognition module from the PCR library:

[0105] CGCGCGCGCGCGCGCGCGT selects modules CG-1, CG-2, CG-3, CG-4, CG-5, CG-6, CG-7, CG-8, CG-9; this connection vector is pEF1a-NLS-TALE backbone- Fok1(R)-pA

[0106] CACTCCCCATCCAGT select modules C-1, A-2, C-3, TC-4, CC-5, CA-6, TC-7, CA-8, GT-9. The connection vector is pEF1a-NLS-TALE backbone-Fok1(L)-IRES-PURO-pA

[0107] (2) According to the following connection system:

[0108] Vector: 150ng

[0109] Modulars: 50ng / modular

[0110] Bsa I (NEB): 1ul

[0111] T4Ligase (fermentas): 1ul

[0112] T4Buffer (NEB): 2ul

[0113] h 2 O: make up 20ul

[0114] The ligation program was: 5 min at 37°C; 15 cycles at 16°C for 10 min; 10 min at 80°C.

[0115] (3) Then plasma-safenuclease digestion: 1h.

[0116] (4) Transform Trans-T1 competent, pi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Described herein are techniques for assembling a polynucleotide encoding a transcription activator-like effector nucleases (TALEN). The techniques ligate and digest necessary modules for a TALEN assembly in one reactor or system. Methods and Kits for generating a TALEN are also described.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a Tale junction unit library, a DNA library comprising all Tale junction units in the Tale junction unit library and a method for constructing a transcription activator-like effector nuclease plasmid. Background technique [0002] It has always been the dream of many scientists to modify the genome according to human wishes. Specifically delete or add the sequences we need on the endogenous genome. On the one hand, various animal models can be constructed for basic biological research and disease mechanism research. On the other hand, animal reactors can be produced to produce what we need cheaply. Biological components that are difficult to obtain from other sources. People have not found a simple and efficient method for genome-targeted modification of the genome. Traditional gene targeting technology relies on the random exchange of homologous chromosomes naturally occurri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C40B40/06C12N15/66
CPCC12N15/102C07H21/00C12Q1/68C12N15/66C12N15/64C12P19/34C12N9/22C12N15/1027C12N15/1031C12N15/10
Inventor 赵金龙吴昭
Owner 浙江煦顼技术有限公司