Supercharge Your Innovation With Domain-Expert AI Agents!

Leukemia fusion gene fluorescence PCR (Polymerase Chain Reaction) detection kit

A technology that integrates genes and kits, and is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., and can solve the problems of not setting positive internal controls, not preventing PCR product contamination, and being unable to monitor false negatives, etc.

Active Publication Date: 2014-04-23
SANSURE (SHANGHAI) GENE TECH LTD
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, these kits are unable to monitor false negatives because there is no positive internal control (i.e. internal standard); and there are generally no measures to prevent PCR product contamination

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Leukemia fusion gene fluorescence PCR (Polymerase Chain Reaction) detection kit
  • Leukemia fusion gene fluorescence PCR (Polymerase Chain Reaction) detection kit
  • Leukemia fusion gene fluorescence PCR (Polymerase Chain Reaction) detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] This embodiment provides a PCR detection kit for leukemia fusion genes BCR / ABL, TEL / AML1, and AML1 / ETO.

[0035] ①Internal standard (positive internal control): It is a recombinant of a 100-base-pair artificially synthesized DNA sequence inserted into the pUC18T vector, that is, a plasmid, with a concentration of 1.00E+04copies / ml~5.00E+04copies / ml, used as Positive internal control in the PCR amplification system to prevent false negatives caused by possible PCR interference substances in the sample; the 100 base pair sequence is as follows: 5'-TAGGACTTAAATCCTATTGTTCCAGCTCTGTCATCCAGTTAGCTGAC TCACGTATTCGTAGCCACCCTTCTGGAGGTGCAATCTCAATTATGTCATCAGG-3';

[0036] ②PCR reaction solution: 5 μl of 10×PCR reaction buffer, 0.2 mmol / L deoxyribonucleoside triphosphate, 0.2 μmol / L~0.4 μmol / L upstream and downstream primers for target polynucleotide amplification, 0.2 μmol / L ~0.4μmol / L probe for target polynucleotide detection, 0.2μmol / L~0.4μmol / L upstream and downstream primers for ...

Embodiment 2

[0054] This example provides the operation steps of the leukemia fusion gene BCR / ABL, TEL / AML1, and AML1 / ETO detection kits in Example 1 for detecting unknown samples such as patient bone marrow tissue.

[0055] 1. Reagent preparation:

[0056] According to the number of samples to be tested, negative control and positive control, take the corresponding amount of PCR reaction solution (38μl / person), enzyme mixture (2μl / person) and internal standard (0.5μl / person) in proportion, fully Mix well to form a PCR-mix, centrifuge briefly and set aside.

[0057] 2. Sample processing and sample addition

[0058] 1) Add 5 μl each of the same sample to be tested, negative control, and positive control to 5 different PCR reaction tubes;

[0059] 2) After standing for 10 minutes, add 45 μl of PCR-mix to each tube, pipette and mix 2-3 times, cover the tube cap (after removing air bubbles), and centrifuge at 2000 rpm for 30 seconds.

[0060] 3. Perform PCR amplification on the fluorescent ...

Embodiment 3

[0069] This embodiment provides another PCR detection kit for leukemia fusion genes BCR / ABL, TEL / AML1, and AML1 / ETO, which can be used to specifically distinguish whether each of the above three fusion genes is negative or positive.

[0070] Among components ①~⑤ of the kit, except for component ②, the other components are the same as those in Example 1.

[0071]Component 2. PCR reaction solutions in this embodiment are three kinds of PCR reaction solutions. Specifically, the first PCR reaction solution contains the primer and probe sequences of the leukemia fusion gene BCR / ABL and the primer-probe sequence of the internal standard. The second PCR reaction solution contains the primer and probe sequences of the leukemia fusion gene TEL / AML1 and the primer probe sequence of the internal standard, while the third PCR reaction solution contains the primer and probe sequences of the leukemia fusion gene AML1 / ETO and internal standard primer probe sequences.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a leukemia fusion gene fluorescence PCR (Polymerase Chain Reaction) detection kit which comprises a PCR reaction liquid, wherein the sequences of the primer and the probe of leukemia fusion gene BCR / ABL in the PCR reaction liquid are as follows: BCR / ABL upstream primer: CGAGTAACATGTCCAGGGACTGGCTG, BCR / ABL downstream primer: GGAAAGGAG TCTACATGCGTTCCTT, BCR / ABL probe: CCGACAACAAAGGCTACCAGTGCGCTTCTA. Preferably, the kit further comprises two other PCR reaction liquids, and one of the two other PCR reaction liquids comprises the primer probe sequence of leukemia fusion gene fluorescence TEL / AML1 and the other one comprises the primer probe sequence of leukemia fusion gene fluorescence AML1 / ETO. By adopting the kit which is rapid to operation, simple and convenient in method and good in detection effect, whether the three fusion genes, namely, BCR / ABL, TEL / AML1 and AML1 / ETO in marrow tissue of patients are positive or negative can be respectively quantitatively detected, so that help is provided for clinical diagnosis and later medication on leukemia.

Description

technical field [0001] The invention relates to a leukemia fusion gene fluorescent PCR detection kit. Background technique [0002] Leukemia is a type of systemic malignant tumor originating from the hematopoietic system, which is highly heterogeneous, but its common feature is the production and accumulation of a large number of immature or abnormal blood cells in the bone marrow. Compared with the corresponding normal blood cells, these abnormal cells have different biological characteristics, often manifested as increased proliferation, impaired differentiation or reduced apoptosis, and can also express some cell surface molecules or secrete some soluble mediators to exert their malignancy. feature. With the increase of these abnormal cells, it can cause the suppression or failure of the normal hematopoietic function of the bone marrow and the immune function of the host, and can enter the blood circulation and invade any other tissues and organs, eventually leading to v...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q2545/101
Inventor 戴立忠肖飞熊晓燕
Owner SANSURE (SHANGHAI) GENE TECH LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com