Recombinant adenovirus rAd-ORF2-TCE and application thereof
A recombinant adenovirus, rad-orf2-tce technology, applied in the field of genetic engineering, can solve the problems of economic loss, can not completely prevent PCV2 infection and spread, etc., achieve the effect of strengthening immunogenicity, improving the level of humoral immunity and cellular immunity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] The present invention will be described in further detail below in conjunction with the accompanying drawings and specific embodiments.
[0028] 1. Construction of recombinant adenovirus rAd-ORF2-TCE transfer vector
[0029] Referring to the PCV2ORF2 gene sequence published by NCBI and the artificially synthesized TCE gene sequence, the application software Primer5.0 designed the following two pairs of primers, which were synthesized by Shanghai Yingjun Company, and used to amplify the target gene fragment.
[0030] P1 (as shown in SEQ ID NO.2): 5-GA AGATCT ATGACGTATCCAAGGAGGCG-3 is the upstream primer of ORF2, and the underlined part is the BglⅡ restriction site;
[0031] P2 (as shown in SEQ ID NO.3): 5- GCTGCCGCCACCGCCGCTTCCGCCACCGCCGCTTCCACC GCCACC AGGGTTAAGTGGGGGGTCT-3 is the downstream primer of ORF2, and the underlined part is the hydrophobic polypeptide (Gly4Ser) 3linker sequence encoding 15 amino acids;
[0032] P3 (as shown in SEQ ID NO.4): 5- GGTGGCGG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 