Recombinant protein HPV6L1 (Human Papilloma Virus 6 L1) and application thereof
A protein and combination technology, applied in the direction of viruses, viral peptides, antiviral agents, etc., can solve the problems of low expression, low yield, and large protein loss.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment l
[0069] Embodiment 1: have the construction of the engineering bacterium of HPV6 L1 sequence 2
[0070] 1、 The full-length HPV6 L1 gene was synthesized by GENEWIZ Biotechnology Co., Ltd. (GENEWIZ). gene sequence SEQ ID NO: 1, which is derived from GeneBank with the accession number NC_001355.1. aa
[0071]2. A template for PCR reaction containing the gene fragment of SEQ ID NO:1. With the forward primer sequence: 5'- CGCGGA TCCGGA AAACCGGACCCGTACAAAAAAC-3'; a restriction endonuclease AccIII site was introduced at the 5' end of the H4 structure, and the sequence of the AccIII site was TCCGGA. The downstream contains an XhoI endonuclease site, and the reverse primer sequence is: 5'-GCTCTCCTCGAG AACACCGGTA CGGATAGAAG A-3', and its 5' end introduces a restriction endonuclease XhoI site, and the sequence of the XhoI site is CTCGAG. HPV6B was amplified by PCR reaction.
[0072] 3. A template containing the gene fragment of SEQ ID NO: 1 for PCR reaction. To contain the introduc...
Embodiment 2
[0078] Embodiment 2: Construction of engineering bacteria with HPV6 L1 sequence 4
[0079] 1. The target gene fragment of the full-length HPV6 L1 gene was purchased from the waste of clinical cell samples containing wild-type HPV6 virus from the Gynecology Clinic of Beijing Anzhen Hospital, and its gene sequence is SEQ ID NO: 3 (AF067044.1).
[0080] 2. A template containing the gene fragment of SEQ ID NO: 3 for PCR reaction. With the forward primer sequence: 5'-CGCGGATCCGGA AAGCCAGATCCCTATAAGAAC -3'; a restriction endonuclease AccIII site was introduced at the 5' end of the H4 structure, and the sequence of the AccIII site was TCCGGA. The downstream contains the XhoI endonuclease site, the reverse primer sequence: 5'-GCTCTCCTCGAG TTAGGCAGCA GAGGCTCTGG AAAC-3', its 5' end introduces the restriction endonuclease XhoI site, and the XhoI site sequence is CTCGAG. Through PCR reaction, HPV6B is amplified.
[0081] 3. A template containing the gene fragment of SEQ ID NO: 3 for...
Embodiment 3
[0086] Embodiment 3: have the construction of the engineering bacterium of HPV6 L1 sequence 6
[0087] 1、 The full-length HPV6 L1 gene was synthesized by GENEWIZ Biotechnology Co., Ltd. (GENEWIZ). gene sequence SEQ ID NO: 5, which is derived from GeneBank with the sequence number HE962027.1.
[0088] 2. A template containing the gene fragment of SEQ ID NO: 3 for PCR reaction. With the forward primer sequence: 5'-CGCGGATCCGGA AAGCCAGATCCCTATAAGAAC-3'; a restriction endonuclease AccIII site was introduced at the 5' end of the H4 structure, and the sequence of the AccIII site was TCCGGA. The downstream contains the XhoI endonuclease site, the reverse primer sequence: 5'-GCTCTCCTCGAG TTAGGCAGCAGAG GCTTTGGAAA C -3', its 5' end introduces the restriction endonuclease XhoI site, and the sequence of the XhoI site is CTCGAG. PCR reaction, amplified to obtain HPV6B.
[0089] 3. A template containing the gene fragment of SEQ ID NO: 3 for PCR reaction. The forward primer sequence co...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
radius | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap