Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant protein HPV6L1 (Human Papilloma Virus 6 L1) and application thereof

A protein and combination technology, applied in the direction of viruses, viral peptides, antiviral agents, etc., can solve the problems of low expression, low yield, and large protein loss.

Active Publication Date: 2014-05-28
BEIJING HEALTH GUARD BIOTECH
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because most of the HPV L1 protein expressed by E. coli loses its natural conformation, it cannot produce protective antibodies against HPV.
Or although the above protein can be purified by inclusion bodies, renaturation and other steps can also obtain HPV VLP, but the loss of protein is large during the renaturation process, and the yield is low, so it is difficult to apply in large-scale production.
Although the full-length sequence protein of HPV L1 can also be solublely expressed in the correct conformation in Escherichia coli and dissolved in the lysed supernatant of the bacteria, the expression level is low, and there are many types and large amounts of foreign proteins in the supernatant. It is quite difficult to purify the target protein, and it is still not applicable to large-scale production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein HPV6L1 (Human Papilloma Virus 6 L1) and application thereof
  • Recombinant protein HPV6L1 (Human Papilloma Virus 6 L1) and application thereof
  • Recombinant protein HPV6L1 (Human Papilloma Virus 6 L1) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment l

[0069] Embodiment 1: have the construction of the engineering bacterium of HPV6 L1 sequence 2

[0070] 1、 The full-length HPV6 L1 gene was synthesized by GENEWIZ Biotechnology Co., Ltd. (GENEWIZ). gene sequence SEQ ID NO: 1, which is derived from GeneBank with the accession number NC_001355.1. aa

[0071]2. A template for PCR reaction containing the gene fragment of SEQ ID NO:1. With the forward primer sequence: 5'- CGCGGA TCCGGA AAACCGGACCCGTACAAAAAAC-3'; a restriction endonuclease AccIII site was introduced at the 5' end of the H4 structure, and the sequence of the AccIII site was TCCGGA. The downstream contains an XhoI endonuclease site, and the reverse primer sequence is: 5'-GCTCTCCTCGAG AACACCGGTA CGGATAGAAG A-3', and its 5' end introduces a restriction endonuclease XhoI site, and the sequence of the XhoI site is CTCGAG. HPV6B was amplified by PCR reaction.

[0072] 3. A template containing the gene fragment of SEQ ID NO: 1 for PCR reaction. To contain the introduc...

Embodiment 2

[0078] Embodiment 2: Construction of engineering bacteria with HPV6 L1 sequence 4

[0079] 1. The target gene fragment of the full-length HPV6 L1 gene was purchased from the waste of clinical cell samples containing wild-type HPV6 virus from the Gynecology Clinic of Beijing Anzhen Hospital, and its gene sequence is SEQ ID NO: 3 (AF067044.1).

[0080] 2. A template containing the gene fragment of SEQ ID NO: 3 for PCR reaction. With the forward primer sequence: 5'-CGCGGATCCGGA AAGCCAGATCCCTATAAGAAC -3'; a restriction endonuclease AccIII site was introduced at the 5' end of the H4 structure, and the sequence of the AccIII site was TCCGGA. The downstream contains the XhoI endonuclease site, the reverse primer sequence: 5'-GCTCTCCTCGAG TTAGGCAGCA GAGGCTCTGG AAAC-3', its 5' end introduces the restriction endonuclease XhoI site, and the XhoI site sequence is CTCGAG. Through PCR reaction, HPV6B is amplified.

[0081] 3. A template containing the gene fragment of SEQ ID NO: 3 for...

Embodiment 3

[0086] Embodiment 3: have the construction of the engineering bacterium of HPV6 L1 sequence 6

[0087] 1、 The full-length HPV6 L1 gene was synthesized by GENEWIZ Biotechnology Co., Ltd. (GENEWIZ). gene sequence SEQ ID NO: 5, which is derived from GeneBank with the sequence number HE962027.1.

[0088] 2. A template containing the gene fragment of SEQ ID NO: 3 for PCR reaction. With the forward primer sequence: 5'-CGCGGATCCGGA AAGCCAGATCCCTATAAGAAC-3'; a restriction endonuclease AccIII site was introduced at the 5' end of the H4 structure, and the sequence of the AccIII site was TCCGGA. The downstream contains the XhoI endonuclease site, the reverse primer sequence: 5'-GCTCTCCTCGAG TTAGGCAGCAGAG GCTTTGGAAA C -3', its 5' end introduces the restriction endonuclease XhoI site, and the sequence of the XhoI site is CTCGAG. PCR reaction, amplified to obtain HPV6B.

[0089] 3. A template containing the gene fragment of SEQ ID NO: 3 for PCR reaction. The forward primer sequence co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
radiusaaaaaaaaaa
Login to View More

Abstract

The invention provides a novel polynucleotide gene segment of coded recombinant protein HPV6L1, a vector containing the gene segment, a host cell containing the vector, a protein HPV6L1 pentamer obtained by translating and expressing the gene segment, and an HPV6 infection-resistant condyloma acuminate vaccine consisting of the pentame.

Description

technical field [0001] The present invention relates to the prevention and / or treatment of human papilloma virus infection. More specifically, the present invention relates to a recombinant human papillomavirus type 6 L1 protein, and a pentamer composed of it, a vaccine containing the protein and its role in preventing HPV6 type virus infection, especially in preventing HPV6 type Use in condyloma acuminatum disease caused by virus infection. [0002] Background technique [0003] Human Papillomavirus (HPV) is a DNA virus transmitted through close contact. In human tissues, HPV mainly infects skin and mucous membrane tissues. HPV can be divided into high-risk type and low-risk type. Long-term persistent infection of high-risk type can cause cancer, such as cervical cancer, and endanger life. Low-risk HPV can cause genital lesions, such as genital warts, affecting quality of life. Condyloma acuminata is a relatively common sexually transmitted disease caused by HPV infect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/025C12N15/37C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C07K19/00A61K39/12A61P31/20
CPCA61K39/00C07K14/005C12N2710/20022C12N2710/20034
Inventor 刘永江陈小江陈林盖大海许铮曹科陈建平潘勇昭银飞阮芳勇
Owner BEIJING HEALTH GUARD BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com