Unlock instant, AI-driven research and patent intelligence for your innovation.

AS-PCR primer design method, gene polymorphism detection method and kit

A technology of gene polymorphism and design method, which is applied in biochemical equipment and methods, microbial measurement/testing, DNA/RNA fragments, etc. It can solve the problems of inability to detect unknown mutation types, complex and time-consuming operations, and difficult popularization of technology, etc. problems, to save the cost of primer synthesis, easy to master, and reduce the effect of operating steps

Active Publication Date: 2014-07-09
SHANGHAI KOYEE BIOTECH CO LTD
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] First, because the AS primers are designed for the mutant type to be tested, the traditional AS-PCR technology can only detect known polymorphic sites, but cannot detect unknown mutation types
[0010] Second, the traditional AS-PCR technology in the detection of amplification results, one is the use of electrophoresis analysis method, this method is complex and time-consuming, high cost, and the technology is difficult to popularize; the other is the use of real-time fluorescent quantitative PCR, which Additional synthesis of fluorescent probes labeled with fluorophores and fluorescent quenchers is also required

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • AS-PCR primer design method, gene polymorphism detection method and kit
  • AS-PCR primer design method, gene polymorphism detection method and kit
  • AS-PCR primer design method, gene polymorphism detection method and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1. AS-PCR detection of human methylenetetrahydrofolate reductase (MTHFR) gene polymorphism:

[0033] For the specific steps and conditions of PCR, please refer to the records in "Molecular Cloning Experiment Guide (Third Edition)" (Chapter 8 "Polymerase Chain Reaction In Vitro Amplification of DNA", pages 597-701, Science Press, August 2002) .

[0034] 1.1. Human MTHFR gene polymorphism AS-PCR primer design:

[0035] Human MTHFR-01 is used to detect the T allele of the SNP (GTCTGCGGGAG A / C CGATTTCAT) site, human MTHFR-02 is used to detect the C allele of the SNP (GTCTGCGGGAG A / CCGATTTCAT) site, and human MTHFR-03 is the downstream primer .

[0036] Human MTHFR-01: 5'-AAGGAGAAGGTGTCTGCGGGAGC–3'

[0037] Human MTHFR-02: 5'-AAGGAGAAGGTGTCTGCGGGAGT–3'

[0038] Human MTHFR-03: 5'-gaaagatcccggggacgatg-3'

[0039] 1.2. Primer modification:

[0040] Human MTHFR-01: 5'(FAM)-AAGGAGAAGGTGTCTGCGGGAGC–(BHQ1)3'

[0041] Human MTHFR-02: 5'(VIC)-AAGGAGAAGGTGTCTGCGGGAGT...

Embodiment 2

[0063] Embodiment 2. Human TfR rs41295879 gene polymorphism primer design and its application:

[0064] 2.1. Human TfR primer design:

[0065] Human TfR-01 is used to detect SNP (AAAATCC A / G GTGTAGGCA) site G allele, human TfR-02 is used to detect SNP (AAAATCC A / G GTGTAGGCA) site A allele, human TfR-03 is downstream primers.

[0066] Human TfR-01: 5'-CCTGGAGCTGCAAAATCCAG–3'

[0067] Human TfR-02: 5'-CCTGGAGCTGCAAAATCCGG–3'

[0068] Human TfR-03: 5'-CACCAATATTCAAAAGAATCAA-3'

[0069] 2.2. Primer modification:

[0070] Human TfR-01: 5'(FAM)-CCTGGAGCTGCAAAATCCAG–(BHQ1) 3'

[0071] Human TfR-02: 5'(VIC)-CCTGGAGCTGCAAAATCCGG–(BHQ1)3'

[0072] 2.3. Template synthesis:

[0073] Synthetic human TfR sequence 1 as template DNA:

[0074] AGCTGATTATATAAGTTCTTTCTTCCTCTTTTTTCTTTTTTAAAGATCACTATGTTGTAGTTGGGGCCCAGAGAGATGCATGGGGCCCTGGAGCTGCAAAATCCAGTGTAGGCACAGCTCTCCTATTGAAACTTGCCCAGATGTTCTCAGATATGGTCTTAAAAGGTAGAGTACAAATTTTGATTCTTTTGAATATTGGTGCACTGCATACAGTTCTAGATGTTATACTGTGCTTTGCTCACTT...

Embodiment 3

[0093] Embodiment 3. Human TfR rs3817672 gene polymorphism primer design and its application:

[0094] 3.1. Human TfR primer design:

[0095] Human TfR-04 is used to detect the G allele of SNP (ACAGACTTCACC A / G GCACCATCAAGT), human TfR-05 is used to detect the A allele of SNP (ACAGACTTCACC A / GGCACCATCAAGT), human TfR-06 is the downstream primer .

[0096] Human TfR-04: 5'-GGACAGCACAGACTTCACCAGC–3'

[0097] Human TfR-05: 5'-GGACAGCACAGACTTCACCGGC–3'

[0098] Human TfR-06: 5'-CCACAGTGTCACCATTATTGTTTC-3'

[0099] 3.2. Primer modification:

[0100] Human TfR-04: 5'(FAM)-GGACAGCACAGACTTCACCAGC–(BHQ1)3'

[0101] Human TfR-05: 5'(VIC)-GGACAGCACAGACTTCACCGGC–(BHQ1)3'

[0102] 3.3. Template synthesis:

[0103] Synthetic human TfR sequence 3 as template DNA:

[0104] ACTTCCCTGCAGCACGTCGCTTATATTGGGATGACCTGAAGAGAAAGTTGTCGGAGAAACTGGACAGCACAGACTTCACCAGCACCATCAAGTGAGTGCCAGCTGCTGTGCAAGTATCTAGACAAGTAATTCAAGAATTATGATAGGCCACGGGGAAACAATAATGGTGACACTGTGGGGAATGGCTTGTTAGAGAAGACAAGACTTGTCATG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an AS-PCR primer design method, a gene polymorphism detection method and a kit. The method and kit are used for detection of a target sequence which probably includes an allelic variation area so as to determine the presence of an allele variant. The AS-PCR primer design method comprises the following steps: (i) designing an AS-PCR primer for a target sequence including an allelic variation area; (ii) modifying the AS-PCR primer designed in step (i) to provide the last base at the 3' end of the AS-PCR primer with a group capable of shielding direct extension of the AS-PCR primer. Compared with traditional AS-PCR with single site detection capability, the gene polymorphism primer design method, the detection method and the kit of the invention can realize fuzzy recognition of mutation sites, can integrate a probe with the primer as one, and thus save the primer synthesis cost and design time; the design is convenient and understandable, and is easy to grasp.

Description

technical field [0001] The invention belongs to the field of nucleic acid diagnostic reagents, in particular to an allele-specific polymerase chain reaction (AS-PCR) primer design method. The present invention also relates to an AS-PCR gene polymorphism detection method and kit, which are used to detect target sequences that may (that is, suspect) contain allelic variation regions to determine allelic variation regions. body exists. Background technique [0002] Allele-specific oligonucleotide analysis (allele-specific oligonucleotide, ASO) is a hybridization-based mutation detection technique, commonly used to detect known mutations. Design an oligonucleotide fragment of, for example, 15-20 bp, which contains the site of a known mutation, and use it as a probe. When hybridizing with sample DNA immobilized on the membrane, the difference of one base will cause Tm The value drops by 5-7.5°C, so by strictly controlling the hybridization conditions, it is possible to identify...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N15/10
CPCC12Q1/6811C12Q2535/125
Inventor 刘小芳黄蔚李丙亮
Owner SHANGHAI KOYEE BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More