Unlock instant, AI-driven research and patent intelligence for your innovation.

Fusion protein efficiently combined with PD-1 and VEGF, and coding sequence and use thereof

A technology of fusion protein and PD-L2, applied in the field of fusion protein, can solve problems such as unaffordable for patients, redundant signaling pathways, and insufficient curative effect of single target therapy

Active Publication Date: 2014-08-06
SHANGHAI ALLBRIGHT BIOTECH +1
View PDF8 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the other hand, the pathogenesis of tumors is complicated, intracellular signaling pathways are redundant or crossed, and the therapeutic effect of a single target is insufficient and drug resistance is easy to form
However, the combination therapy of multiple monoclonal antibodies targeting different targets is better than single target therapy, but the cost is very expensive and unaffordable for patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein efficiently combined with PD-1 and VEGF, and coding sequence and use thereof
  • Fusion protein efficiently combined with PD-1 and VEGF, and coding sequence and use thereof
  • Fusion protein efficiently combined with PD-1 and VEGF, and coding sequence and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Example 1: Design and synthesis of fusion protein expression cassettes and construction of expression vectors

[0088] According to the amino acid sequence and the coding sequence of each component of the fusion protein, the amino acid sequence and the coding DNA expression frame of the whole fusion are spliced ​​into, wherein:

[0089] The amino acid residue sequence of the extracellular domain of PD-L2 is:

[0090] LFTVTVPKELYIIEHGSNVTLECNFDTGSHVNLGAITASLQKVENDTSPHRERATLLEEQLPLGKASFHIPQVQVRDEGQYQCIIIYGVAWDYKYLTLKVKASYRKINTHILKVPETDEVELTCQATGYPLAEVSWPNVSVPANTSHRSRTPEGLYQVTSVLRLKPPPGRNOWSCQFWNTHQVRELTLAS

[0091] The coding sequence of the extracellular region of PD-L2 is:

[0092] CTCTTTACTGTGACCGTGCCAAAAGAACTGTATATCATTGAGCACGGGTCCAATGTGACCCTCGAATGTAACTTTGACACCGGCAGCCACGTTAACCTGGGGGCCATCACTGCCAGCTTGCAAAAAGTTGAAAACGACACTTCACCTCACCGGGAGAGGGCAACCCTCTTGGAGGAGCAACTGCCATTGGGGAAGGCCTCCTTTCATATCCCTCAGGTGCAGGTTCGGGATGAGGGACAGTACCAGTGCATTATTATCTACGGCGTGGCTTGGGATTACAAGTATCTGAC...

Embodiment 2

[0134] Embodiment 2: Expression and purification of fusion protein

[0135] The high-quality plasmids of each recombinant expression vector constructed and purified in Example 1 were transfected into 293 cells (embryonic kidney cells, purchased from American Type Collection, ATCC) using Lipofectamine2000 (Invitrogen). After 2 days, the transfected 293 cells were transferred to DMEM medium with neomycin, and the cells were cloned by limiting dilution method. After 21 days of selection, a neomycin-resistant cell line stably transfected with the corresponding expression vector was established. Then, a large number of stably transfected cells were expanded by shaking flask culture, the culture supernatant was collected, and each fusion protein was purified by gel filtration affinity chromatography. The molecular weights of PVP1, PVP2, PVP3, and PVP4 are 73.3KD, 73.3KD, 72.7KD, and 72.7KD, respectively, and the concentration of the purified fusion protein was determined by ELISA...

Embodiment 3

[0136] Example 3: Determination of the affinity constant of the fusion protein with PD-1 and VEGF

[0137] The fusion protein PVP1 prepared in Example 2 was added to a 96-well plate (10 μg / ml, 200 μl), and then loaded onto an anti-human IgG Fc capture biosensor (Anti-Human IgG Fc Capture biosensor, Octet), and then applied to a biomacromolecule The interaction instrument (Octet Red96) was used to measure its affinity with different concentrations (1000nM, 500nM, 250nM, 125nM, 62.5nM, 0nM) of recombinant human PD-1 and VEGF protein (200μl, SinoBiological lnc.), and the measured PVP1 and The affinity constants Kd of PD-1 and VEGF are 97.3nM respectively (see figure 2 ) and 30.2nM (see image 3 ). Those skilled in the art know that generally Kd is less than 10 -7 (That is, 100nM, the smaller the affinity, the higher the affinity), it means that the two proteins can be combined efficiently. Of course, this affinity is still relatively low compared to the affinity between an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biological medicine field, and relates to a fusion protein efficiently combined with a PD-1 and a VEGF, and a coding sequence and a use thereof. Specifically, the invention relates to the separated fusion protein comprising the following peptide fragments: (1) a human PD-L2 extracellular region peptide fragment; (2) a peptide fragment of a second immunoglobulin-like structural domain of a human FLT-1 extracellular region or / and a peptide fragment of a third immunoglobulin-like structural domain of a KDR extracellular region; and optionally (3) a human immunoglobulin Fc fragment. The fusion protein can inhibit the growth of tumor cells, promotes the death of the tumor cells, inhibits T cell inactivation, and enhances a tumor killing ability.

Description

technical field [0001] The invention belongs to the field of biomedicine, and relates to a fusion protein efficiently combined with PD-1 and VEGF, its coding sequence and application. Background technique [0002] Monoclonal antibodies have clear targets, are safe in clinical application, and have obvious curative effects. At present, a total of 10 tumor monoclonal antibodies have been approved for marketing by the US FDA, and have become the first-line drugs for the treatment of various types of malignant tumors. However, on the one hand, the full-length antibody has a large molecular weight, and it is difficult to enter solid tumor tissues, and it is difficult to achieve an effective therapeutic concentration inside the tumor, thereby exerting anti-tumor efficacy. On the other hand, the pathogenesis of tumors is complex, intracellular signaling pathways are redundant or crossed, and the therapeutic effect of a single target is insufficient and drug resistance is easy to fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63C12N1/21C12N1/15C12N5/10A61K38/17A61K48/00A61P35/00A61P35/04
Inventor 钱其军金华君王倩丁娜严巧灵刘辉俞德超李林芳吴孟超
Owner SHANGHAI ALLBRIGHT BIOTECH