Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Quantitative detection method of antibiotics resistance gene in soil

A quantitative detection method and antibiotic resistance technology, applied in the detection field of soil environmental pollutants, can solve the problems of no resistance gene and low sensitivity

Active Publication Date: 2014-08-13
ZHEJIANG UNIV
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no commercial resistance gene standard product, and ordinary PCR can only detect the presence or absence of the gene qualitatively, and the sensitivity is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quantitative detection method of antibiotics resistance gene in soil
  • Quantitative detection method of antibiotics resistance gene in soil
  • Quantitative detection method of antibiotics resistance gene in soil

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1, Quantitative detection of penicillin resistance gene blaTEM in different soils

[0050] The β-lactamase encoded by blaTEM can invalidate penicillin. Get fresh forest soil, pasture soil, and tea garden soil to measure the soil water content. Each soil sample and pig manure sample weigh 0.25g to extract DNA, and the volume is 100 μ L [the pig manure The feces produced by pigs taking antibiotics for a long time; the DNA of the above soil samples and pig manure samples were extracted using the Fast DNA spin kit for soil].

[0051] 30 known blaTEM gene sequences (GenBank database) were selected for comparison, and it was found that the blaTEM gene was well conserved. The primers were redesigned according to the conserved sequences, and the generated target fragment was 129 bp. This pair of primers can be considered as universal primers for detecting blaTEM gene.

[0052] Use pig feces sample DNA as a template for PCR. The common PCR reaction system is a 20 μL rea...

Embodiment 2

[0060] Example 2, Quantitative comparison of tetracycline resistance genes tetC and tetM in different soils

[0061] tetC encodes an efflux pump protein, which can excrete tetracycline out of the cell, thereby reducing the intracellular drug concentration to play a protective role. tetM encodes a ribosome protection protein, which causes a change in ribosome configuration, preventing tetracycline from binding to ribosomes and failing.

[0062] Get fresh forest soil, pasture soil, tea garden soil and measure soil water content, each soil sample and pig manure sample weigh 0.25g to extract DNA, and volume is 100 μ L [the described pig manure is the excrement that the pig place that takes antibiotic for a long time; The above-mentioned soil The DNA of the soil samples and pig manure samples were extracted with the Fast DNA spin kit for soil].

[0063] The primer sequences before and after tetC are GCGGGATATCGTCCATTCCG, GCGTAGAGGATCCACAGGACG, respectively, and the target fragment ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
PCR efficiencyaaaaaaaaaa
PCR efficiencyaaaaaaaaaa
PCR efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention discloses a quantitative detection method of antibiotics resistance gene in soil. The method comprises the following steps: (1) selecting pigs which usually eat antibiotics, taking the pig manure DNA as the template, amplifying the target resistance gene sections by PCR; (2) carrying out gel extraction and purifying the amplified target resistance gene, inoculating the resistance gene onto a T carrier, converting to competence colibacillus cells, coating the cells on a LB plate, selecting the positive clones; (3) detecting the quality of amplified culture bacterium liquid through an agarose gel electrophoresis (AGE) method, extracting plasmids from bacterium liquid in which target resistance gene has been successfully cloned, measuring the plasmid concentration, calculating the copy number of the resistance genes carried by the plasmids, diluting the bacterium liquid as the resistance gene standard for later use by taking 10 times as the dilution gradient; (4) extracting soil genome DNA, simultaneously carrying out quantitative PCR amplification on the soil sample DNA and the resistance gene standard, and finally figuring out the copy number of the resistance gene in the soil sample.

Description

technical field [0001] The invention belongs to the technical field of detection of soil environmental pollutants, and in particular relates to a quantitative detection method of antibiotic resistance genes in soil. Background technique [0002] In 1928, Alexander Fleming discovered penicillin. In the 1940s, penicillin was put into large-scale production, and then streptomycin, tetracycline, vancomycin, methicillin and other antibiotics were discovered one after another. my country is a big producer and consumer of antibiotics. In 2007, 210,000 tons of antibiotics were produced. In addition to exporting about 30,000 tons, 180,000 tons were used domestically (among them, aquaculture accounted for 97,000 tons). At present, antibiotics have been widely used in the prevention and treatment of human and animal diseases, and are also used as growth promoters to increase the growth rate of livestock and poultry. It has become a habit to use a large amount of antibiotics in modern ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6851C12Q2531/113C12Q2537/16C12Q2545/113
Inventor 张奇春侯昌萍
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com