Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of gene Mindin in hepatic ischemia reperfusion injury

A technology for reperfusion injury and liver ischemia, applied in the field of gene function and application

Active Publication Date: 2014-09-24
武汉惠康基因科技有限公司
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no international literature report on the application of Mindin gene in liver ischemia-reperfusion injury

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene Mindin in hepatic ischemia reperfusion injury
  • Application of gene Mindin in hepatic ischemia reperfusion injury
  • Application of gene Mindin in hepatic ischemia reperfusion injury

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] [Example 1] Construction of liver cell-specific Mindin transgenic mice:

[0035] To further study the effect of Mindin overexpression on liver ischemia-reperfusion injury, we constructed several hepatocyte-specific Mindin transgenic mice (Mindin-TG). Transgenic vector construction information: use the upstream primer, namely 5'- GAACTCGAGCCACCATGGAAAACTTGAGTCTTGC -3'; the downstream primer, namely 5'- GAATGCGGCCGCTTAGACGCAGTTATCTGGGG-3', to amplify the full-length mouse Mindin gene (NCBI, Gene ID: 100689, NM_133903.3) , the cDNA was inserted downstream of the albumin (Albumin) promoter, and the constructed vector was constructed into fertilized embryos (C57BL / 6J background) by microinjection, and liver cell-specific Mindin transgenic mice were obtained.

[0036] The expression of Mindin protein in the liver of different transgenic mice was identified by Western Blot experiment: the liver tissue proteins of different transgenic mice were extracted, and analyzed by polyac...

Embodiment 2

[0038] [Example 2] A mouse liver ischemia-reperfusion injury model (ischemia / reperfusion injury, I / R) was obtained

[0039] 1. Grouping of experimental animals: Males aged 8-10 weeks and weighing 22-27 grams were included in the experiment

[0040] C57BL / 6 wild-type mice, Mindin knockout mice, Mindin transgenic mice and non-transgenic mice were used to establish liver ischemia model (I / R) through liver ischemia-reperfusion. They were randomly divided into 8 groups: C57BL / 6J strain wild-type mouse sham operation group (WT SHAM) and I / R operation group (WT I / R), Mindin gene knockout mouse sham operation group (KO SHAM) and I / R operation group R operation group (KO I / R), non-transgenic mouse sham operation group (NTG SHAM) and I / R operation group (NTG I / R), liver cell-specific Mindin transgenic mouse sham operation group (TG SHAM) and I / R surgery group (TG I / R).

[0041] 2. I / R operation of the liver ischemia-reperfusion injury model (the portal vein and hepatic artery in the m...

Embodiment 3

[0047] [Example 3] Determination of liver necrosis area and liver function indexes (AST, ALT)

[0048] The evaluation indicators of the severity of liver ischemia-reperfusion injury mainly include the area of ​​liver necrosis and liver function indicators (AST, ALT), all of which are positively correlated with the severity of liver ischemia-reperfusion injury.

[0049] 1. Take materials

[0050] Mice were killed by cervical dislocation in the sham operation group (Sham) and at 12h, 24h, and 48h after ischemia-reperfusion, and 1ml of blood was collected from the inferior vena cava immediately to separate the serum. At the same time, the left lobe of the liver in the ischemic area with a size of about 1.5cm×1cm×0.2cm was fixed in 10% neutral formalin for 24 hours, dehydrated, embedded, paraffin-sectioned, and then stained with HE. (Separation of serum: the EP tube that collects the blood is left at room temperature for 1-2 hours to allow the blood to coagulate naturally. Centri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene Mindin and an application of an inhibitor thereof in a hepatic ischemia reperfusion injury, and belongs to the field of functions and applications of genes. After the experiment is carried out through a hepatic ischemia reperfusion injury model by taking a gene Mindin knockout rat and a Mindin transgenosis rat with a hepatic cell specificity as experimental subjects, the result shows that the hepatic necrosis of the gene Mindin knockout rat is obviously inhibited and the hepatic function of the gene Mindin knockout rat is obviously improved in comparison with a wild-type C57 rat, but the hepatic necrosis of the Mindin transgenosis rat with the hepatic cell specificity is obviously increased and the hepatic function of the hepatic necrosis Mindin transgenosis rat is seriously deteriorated. Thus, the gene Mindin has a function of deteriorating hepatic cells, especially, the gene Mindin has the function of deteriorating the hepatic ischemia reperfusion injury. Aiming at the function of the gene Mindin, the gene Mindin can serve as a medicine target for screening medicines for treating the hepatic ischemia reperfusion injury. The inhibitor of the gene Mindin can be used for preparing the medicines for treating the hepatic ischemia reperfusion injury.

Description

technical field [0001] The invention belongs to the field of gene function and application, and in particular relates to the application of Mindin (Spondin 2) as a drug target in the screening of drugs for the treatment of liver ischemia-reperfusion injury, and the use of Mindin inhibitors in the preparation of drugs for the treatment of liver ischemia-reperfusion injury application in medicines. Background technique [0002] Ischemia-reperfusion injury refers to the pathological changes of cells caused by tissue ischemia and hypoxia for a certain time and degree. After the blood supply is restored, the diseased cells may not recover their functions, but will be further aggravated under certain conditions. Extensive liver lobectomy and liver transplantation often require partial or complete blockage of liver blood flow, and the liver is a very sensitive organ to ischemia and hypoxia, so ischemia-reperfusion injury will inevitably occur. The mechanism of hepatic ischemia rep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K49/00A61K48/00A61K45/00A61K39/395A61P1/16A61P9/10
Inventor 李红良王丕晓朱丽华
Owner 武汉惠康基因科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More