Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for identifying seed purity of muskmelon hybrid variety based on EST-SSR (expressed sequence tag-simple sequence repeat) marker

A hybrid and melon technology, applied in agricultural vegetable breeding and application fields, can solve the problems of less SSR and limited number of EST, and achieve the effect of convenient operation, easy observation and analysis, and good stability

Inactive Publication Date: 2014-09-24
TIANJIN RES INST OF VEGETABLE +1
View PDF4 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The development and application of EST-SSR in Cucurbitaceae melon crops is still in the initial stage, due to the limited amount of EST derived from watermelon, melon and cucumber, the available SSR is relatively small

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying seed purity of muskmelon hybrid variety based on EST-SSR (expressed sequence tag-simple sequence repeat) marker
  • Method for identifying seed purity of muskmelon hybrid variety based on EST-SSR (expressed sequence tag-simple sequence repeat) marker
  • Method for identifying seed purity of muskmelon hybrid variety based on EST-SSR (expressed sequence tag-simple sequence repeat) marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] (1) Reagents: GoTaq® Master Mixes solution produced by Promega; EST-SSR primers synthesized by Shanghai Sangon;

[0053] (2) The sequence list of EST-SSR primers is as follows:

[0054] Primer name sequence(5'to3') SSR forward primer GCACGAGGCTCAACTACC SSR reverse primer GAGACCGAAATTGAAGAATAG

[0055] (3) Sampling and DNA extraction

[0056] Take the female parent seedlings of the tested varieties (Tianjin Kerun Vegetable Research Institute), freeze and grind them with liquid nitrogen (Retsch MM400 biological pulverizer), add CTAB lysis buffer (20g / L CTAB, 1.4M NaCl, 0.1M Tris-HCl, 20mM Na 2 EDTA) 500 μL, lysed in a 65°C constant temperature water bath (Neslab) for 30 minutes, and the subsequent DNA extraction and purification were performed according to the resin-type genomic DNA purification kit (Saibaisheng). After DNA extraction, the concentration was uniformly diluted to 50±1 ng / μL, Nanodrop ND1000, Thermol). The DNA extraction meth...

Embodiment 2

[0063] (1) Reagents: GoTaq® Master Mixes solution produced by Promega; EST-SSR primers synthesized by Shanghai Sangon;

[0064] (2) The sequence list of EST-SSR primers is as follows:

[0065] Primer name sequence(5'to3') SSR forward primer GCACGAGGCTCAACTACC SSR reverse primer GAGACCGAAATTGAAGAATAG

[0066] (3) Sampling and DNA extraction

[0067] The male seedlings of the tested varieties were taken from the male parent (Tianjin Kerun Vegetable Research Institute), frozen and ground in liquid nitrogen (Retsch MM400 bio-shredder), and CTAB lysis buffer (20 g / L CTAB, 1.4 M NaCl, 0.1 M Tris-HCl, 20 mM Na2EDTA) 500 μL, lysed in a constant temperature water bath (Neslab) at 65°C for 30 min, and subsequent DNA extraction and purification were performed according to the resin-based genomic DNA purification kit (Saibaisheng). After DNA extraction, the concentration was uniformly diluted to 50±1 ng / μL, Nanodrop ND1000, Thermol). The DNA extraction meth...

Embodiment 3

[0074] (1) Reagents: GoTaq® Master Mixes solution produced by Promega; EST-SSR primers synthesized by Shanghai Sangon;

[0075] (2) The sequence list of EST-SSR primers is as follows:

[0076] Primer name sequence(5'to3') SSR forward primer GCACGAGGCTCAACTACC SSR reverse primer GAGACCGAAATTGAAGAATAG

[0077] (3) Sampling and DNA extraction

[0078]50 individual plants of the hybrids (Tianjin Kerun Vegetable Research Institute) were used for the tested variety, frozen and ground in liquid nitrogen (Retsch MM400 biocrusher), and CTAB lysis buffer (20 g / L CTAB, 1.4 M NaCl, 0.1 M Tris- HCl, 20 mM Na2EDTA) 500 μL, lysed in a constant temperature water bath (Neslab) at 65°C for 30 min, and the subsequent DNA extraction and purification were performed according to the resin-based genomic DNA purification kit (Saibaisheng). After DNA extraction, the concentration was uniformly diluted to 50±1 ng / μL, Nanodrop ND1000, Thermol). The DNA extraction method c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for identifying seed purity of a muskmelon variety namely green angel hybrid variety based on an EST-SSR (expressed sequence tag-simple sequence repeat) marker. The method comprises the following steps: using the muskmelon variety namely green angel hybrid variety and parental genome DNA (deoxyribonucleic acid) of the muskmelon variety namely green angel hybrid variety as a template; designing 57 pairs of EST-SSR primers by using Primer 3.0 online primer design through 214 muskmelon EST sequences published by a GeneBank database; obtaining a pair of complementary band type primers of which the hybrid variety band type is parental by screening. By virtue of a field verification test, the primer is good in stability, is relatively matched with results of the field test, and can be used for performing purity identification on the muskmelon hybrid variety. A detection method disclosed by the invention can be used for completing seed purity identification within 3 hours, and has the advantages of high speed, low cost, convenience in operation and the like.

Description

technical field [0001] The invention belongs to the technical field of agricultural vegetable breeding and application, and relates to a method for identifying the purity of melon hybrids, in particular to a method for identifying the purity of hybrid seeds based on EST-SSR molecular marker technology. Background technique [0002] Seeds are the most basic and critical means of production in agricultural production, and their purity is the main indicator to directly measure the quality of seeds. The reduction of seed purity will significantly reduce the yield and product quality of crops, causing farmers to suffer huge economic losses. The traditional identification method of seed purity is based on the field observation of the plant after sowing, which has a long cycle, heavy workload, and is easily affected by environmental and seasonal factors, resulting in deviations in the results. Therefore, the development of fast and accurate seed purity identification methods has b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q1/6895C12Q2600/156C12Q2531/113C12Q2565/125
Inventor 张若纬李欧静彭冬秀兰庆阔武云鹏王永李秀秀
Owner TIANJIN RES INST OF VEGETABLE