Method for identifying seed purity of muskmelon hybrid variety based on EST-SSR (expressed sequence tag-simple sequence repeat) marker
A hybrid and melon technology, applied in agricultural vegetable breeding and application fields, can solve the problems of less SSR and limited number of EST, and achieve the effect of convenient operation, easy observation and analysis, and good stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] (1) Reagents: GoTaq® Master Mixes solution produced by Promega; EST-SSR primers synthesized by Shanghai Sangon;
[0053] (2) The sequence list of EST-SSR primers is as follows:
[0054] Primer name sequence(5'to3') SSR forward primer GCACGAGGCTCAACTACC SSR reverse primer GAGACCGAAATTGAAGAATAG
[0055] (3) Sampling and DNA extraction
[0056] Take the female parent seedlings of the tested varieties (Tianjin Kerun Vegetable Research Institute), freeze and grind them with liquid nitrogen (Retsch MM400 biological pulverizer), add CTAB lysis buffer (20g / L CTAB, 1.4M NaCl, 0.1M Tris-HCl, 20mM Na 2 EDTA) 500 μL, lysed in a 65°C constant temperature water bath (Neslab) for 30 minutes, and the subsequent DNA extraction and purification were performed according to the resin-type genomic DNA purification kit (Saibaisheng). After DNA extraction, the concentration was uniformly diluted to 50±1 ng / μL, Nanodrop ND1000, Thermol). The DNA extraction meth...
Embodiment 2
[0063] (1) Reagents: GoTaq® Master Mixes solution produced by Promega; EST-SSR primers synthesized by Shanghai Sangon;
[0064] (2) The sequence list of EST-SSR primers is as follows:
[0065] Primer name sequence(5'to3') SSR forward primer GCACGAGGCTCAACTACC SSR reverse primer GAGACCGAAATTGAAGAATAG
[0066] (3) Sampling and DNA extraction
[0067] The male seedlings of the tested varieties were taken from the male parent (Tianjin Kerun Vegetable Research Institute), frozen and ground in liquid nitrogen (Retsch MM400 bio-shredder), and CTAB lysis buffer (20 g / L CTAB, 1.4 M NaCl, 0.1 M Tris-HCl, 20 mM Na2EDTA) 500 μL, lysed in a constant temperature water bath (Neslab) at 65°C for 30 min, and subsequent DNA extraction and purification were performed according to the resin-based genomic DNA purification kit (Saibaisheng). After DNA extraction, the concentration was uniformly diluted to 50±1 ng / μL, Nanodrop ND1000, Thermol). The DNA extraction meth...
Embodiment 3
[0074] (1) Reagents: GoTaq® Master Mixes solution produced by Promega; EST-SSR primers synthesized by Shanghai Sangon;
[0075] (2) The sequence list of EST-SSR primers is as follows:
[0076] Primer name sequence(5'to3') SSR forward primer GCACGAGGCTCAACTACC SSR reverse primer GAGACCGAAATTGAAGAATAG
[0077] (3) Sampling and DNA extraction
[0078]50 individual plants of the hybrids (Tianjin Kerun Vegetable Research Institute) were used for the tested variety, frozen and ground in liquid nitrogen (Retsch MM400 biocrusher), and CTAB lysis buffer (20 g / L CTAB, 1.4 M NaCl, 0.1 M Tris- HCl, 20 mM Na2EDTA) 500 μL, lysed in a constant temperature water bath (Neslab) at 65°C for 30 min, and the subsequent DNA extraction and purification were performed according to the resin-based genomic DNA purification kit (Saibaisheng). After DNA extraction, the concentration was uniformly diluted to 50±1 ng / μL, Nanodrop ND1000, Thermol). The DNA extraction method c...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
