Chicken B,D,E-subgroup avian leukaemia genetic resistance related mononucleotide polymorphism molecular marker and application thereof

A single nucleotide polymorphism, avian leukemia technology, applied in the direction of recombinant DNA technology, DNA / RNA fragments, animal husbandry, etc., to achieve the effect of strong purpose and strong operability

Inactive Publication Date: 2014-11-19
SOUTH CHINA AGRI UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At home and abroad, there is no report on the identification me...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chicken B,D,E-subgroup avian leukaemia genetic resistance related mononucleotide polymorphism molecular marker and application thereof
  • Chicken B,D,E-subgroup avian leukaemia genetic resistance related mononucleotide polymorphism molecular marker and application thereof
  • Chicken B,D,E-subgroup avian leukaemia genetic resistance related mononucleotide polymorphism molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Identification of Genetic Resistance Genotypes with TVB298 Primer

[0028] 1. PCR amplification of the target fragment

[0029] According to the SNP site at position 298 on the coding sequence of the known TVB gene, the amplification primer pair TVB298 of PCR-RFLP was designed with the DNA sequence of the TVB gene (GenBank accession number: NC_006109.3), wherein the upstream primer TVB298-1: 5'-GTGGGCAAGGTAAAACTCCA-3' (SEQ ID NO: 1), downstream primer TVB298-2: 5'-GTGGGCAAGGTAAAACTCCA-3' (SEQ ID NO: 2).

[0030] Select sample chickens with known resistance genotypes, numbered 1 (marked CC, genotype SS, susceptible), 2 (marked CT, genotype SR3, susceptible) and 3 (marked TT, genotype Three chickens whose genotype is R3R3 (resistance) were extracted from chicken genomic DNA as a template, and PCR was performed with primers TVB298-1 and TVB298-2.

[0031] The composition of the PCR reaction system is as follows: template 1 μL, 10×buffer 10 μL, dNTPs 8 μL, pri...

Embodiment 2

[0036] Example 2 Identification and breeding of resistant chickens

[0037] Using the established B, D, E-subgroup avian leukemia genetically resistant chicken identification method, 642 original breeder chicken clinical samples were identified, and 346 B, D, E-subgroup avian leukemia genetically resistant chicken samples were identified. Select 20 breeding chicken samples (both male and female are resistant chickens) from 346 samples to cross, and obtain 52 F1 generation chicks (theoretically all are genetically resistant chickens), 1-day-old sarcoma Rou's virus (1000ffu ), tumor examination was carried out after 5 months of age, and no tumors appeared in all chickens. It is proved that this method has very good application value.

Embodiment 5

[0038] Other primer sequences designed in Example 5 can also identify genetically resistant chickens

[0039] Use the DNA sequence of TVB gene (GenBank accession number: NC_006109.3) to design the amplification primer pair tvb of PCR-RFLP, design upstream primer tvb1: GAAAGCAGGCGTAATGGTGTCC (SEQ ID NO: 3) and downstream primer tvb2: TGGGAGACAAACGCAGAGCAG (SEQ ID NO: 4). Chicken genomic DNA was extracted, and the fragment amplified with primers tvb1 and tvb2 was 1300bp in length. The composition of the PCR reaction system is as follows: template 1 μL, 10×buffer 10 μL, dNTPs 8 μL, primer tvb1 1 μL, primer tvb2 1 μL, Bland Taq 1 μL, ddH 2 O to make up to 100 μL. PCR reaction program: pre-denaturation at 94°C for 3min, 1 cycle; 94°C for 40s, 67°C for 40s, 72°C for 1min, 35 cycles; extension at 72°C for 10min.

[0040] A specific band of about 1625bp can be observed when the PCR product is detected by 2% agarose gel electrophoresis, see image 3 . use Afl III endonuclease (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a chicken B,D,E-subgroup avian leukaemia genetic resistance related mononucleotide polymorphism molecular marker and application thereof. The molecular marker is TVB gene DNA (deoxyribonucleic acid) sequence SNP-3674C/T, or TVB gene coding sequence SNP-298C/T. The molecular marker can be used for identifying chicken B,D,E-subgroup avian leukaemia genetic resistance characteristics; correspondingly, the molecular marker can be distinguished by a PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) process, and can be used for resistance breeding to control the risk of B,D,E-subgroup avian leukaemia from the source; and the molecular marker has the advantages of high purposiveness and the like, is simple to operate and easy to implement, greatly lowers the screening cost, and thus, has important practical meanings.

Description

technical field [0001] The invention relates to the technical field of molecular detection, in particular to a single nucleotide polymorphism molecular marker related to the genetic resistance of chicken B, D, E-subgroup avian leukemia and its application. Background technique [0002] my country is a big producer and consumer of broiler chickens, and the output of broiler chickens ranks second in the world. In 2010, the annual slaughter rate of high-quality chickens in my country reached 5 billion, accounting for about 50% of China's broiler production. China has become the world's largest high-quality chicken production base and consumer market. The dominant position in the international market is obvious. Years of epidemiological survey results show that the incidence of avian leukosis in high-quality chickens is higher than that of fast and large broilers, and it has become one of the main diseases threatening the high-quality chicken industry. The current method of con...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/11C12Q1/68A01K67/027
Inventor 谢青梅李鸿鑫舒鼎铭张焕民陈伟国
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap