Chicken B,D,E-subgroup avian leukaemia genetic resistance related mononucleotide polymorphism molecular marker and application thereof
A single nucleotide polymorphism, avian leukemia technology, applied in the direction of recombinant DNA technology, DNA / RNA fragments, animal husbandry, etc., to achieve the effect of strong purpose and strong operability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Identification of Genetic Resistance Genotypes with TVB298 Primer
[0028] 1. PCR amplification of the target fragment
[0029] According to the SNP site at position 298 on the coding sequence of the known TVB gene, the amplification primer pair TVB298 of PCR-RFLP was designed with the DNA sequence of the TVB gene (GenBank accession number: NC_006109.3), wherein the upstream primer TVB298-1: 5'-GTGGGCAAGGTAAAACTCCA-3' (SEQ ID NO: 1), downstream primer TVB298-2: 5'-GTGGGCAAGGTAAAACTCCA-3' (SEQ ID NO: 2).
[0030] Select sample chickens with known resistance genotypes, numbered 1 (marked CC, genotype SS, susceptible), 2 (marked CT, genotype SR3, susceptible) and 3 (marked TT, genotype Three chickens whose genotype is R3R3 (resistance) were extracted from chicken genomic DNA as a template, and PCR was performed with primers TVB298-1 and TVB298-2.
[0031] The composition of the PCR reaction system is as follows: template 1 μL, 10×buffer 10 μL, dNTPs 8 μL, pri...
Embodiment 2
[0036] Example 2 Identification and breeding of resistant chickens
[0037] Using the established B, D, E-subgroup avian leukemia genetically resistant chicken identification method, 642 original breeder chicken clinical samples were identified, and 346 B, D, E-subgroup avian leukemia genetically resistant chicken samples were identified. Select 20 breeding chicken samples (both male and female are resistant chickens) from 346 samples to cross, and obtain 52 F1 generation chicks (theoretically all are genetically resistant chickens), 1-day-old sarcoma Rou's virus (1000ffu ), tumor examination was carried out after 5 months of age, and no tumors appeared in all chickens. It is proved that this method has very good application value.
Embodiment 5
[0038] Other primer sequences designed in Example 5 can also identify genetically resistant chickens
[0039] Use the DNA sequence of TVB gene (GenBank accession number: NC_006109.3) to design the amplification primer pair tvb of PCR-RFLP, design upstream primer tvb1: GAAAGCAGGCGTAATGGTGTCC (SEQ ID NO: 3) and downstream primer tvb2: TGGGAGACAAACGCAGAGCAG (SEQ ID NO: 4). Chicken genomic DNA was extracted, and the fragment amplified with primers tvb1 and tvb2 was 1300bp in length. The composition of the PCR reaction system is as follows: template 1 μL, 10×buffer 10 μL, dNTPs 8 μL, primer tvb1 1 μL, primer tvb2 1 μL, Bland Taq 1 μL, ddH 2 O to make up to 100 μL. PCR reaction program: pre-denaturation at 94°C for 3min, 1 cycle; 94°C for 40s, 67°C for 40s, 72°C for 1min, 35 cycles; extension at 72°C for 10min.
[0040] A specific band of about 1625bp can be observed when the PCR product is detected by 2% agarose gel electrophoresis, see image 3 . use Afl III endonuclease (...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 