Kit for rapid identification of purity of new sunflower No.19 of oil sunflower
A kit and oil sunflower technology, applied in the field of biological kits for rapid identification of the purity of oil sunflower new sunflower 19 varieties, can solve the problem that there is no standard procedure for rapid biochemical or DNA molecular detection technology, and achieve the elimination of reagent configuration. and specific primer screening process, speeding up the quality inspection process, and the effect of speeding up the identification time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Kit for quickly identifying the purity of oil sunflower Xinkui No. 19 variety
[0040] The invention provides a kit for identifying the male parent, female parent and hybrid species of Xinkui No. 19 at the same time. The kit includes:
[0041] (1) Oil sunflower DNA rapid extraction kit A configuration: 50mmol / L Tris-HCl pH8, 0.7 mmol / L NaCl, 10 mmol / L EDTA, pH8, 1% CTAB, 20mmol / L 2-mercaptoethanol.
[0042] (2) Configuration of PCR amplification reaction kit B: 5×4ul reaction buffer, 25mmol / L MgCl 2 Solution 2ul, 0.1mmol / L dNTPs solution 3ul, 1umol / L Primer solution 3ul (SSR primer markers 399 and 425), 5u Taq DNA polymerase 0.2ul.
[0043] 1-5ng template DNA; total reaction volume is 20ul, the amplification program is denaturation at 95°C for 2min, denaturation at 94°C for 45s, annealing at 57°C for 45s, extension at 72°C for 60s, total 30 cycles; extension at 72°C for 8min.
[0044] Primer label 399:
[0045] Left sequence CGTACGGTGTAGTTCTCATGGT;
[0046] Right sequen...
Embodiment 2
[0052] Example 2: Rapid identification of the purity of oil sunflower Xinkui No. 19
[0053] A method for quickly identifying the purity of oil sunflower Xinkui No. 19, the specific method steps are as follows:
[0054] (1) Oil sunflower DNA rapid extraction reagent contains 50mmol / L Tris-HCl pH8, 0.7 mmol / L NaCl, 10 mmol / L EDTA, pH8, 1% CTAB, 20mmol / L 2-mercaptoethanol.
[0055] (2) PCR amplification reaction reagent contains 4ul of 5×reaction buffer, 25mmol / L MgCl 2 Solution 2ul, 0.1mmol / L dNTPs solution 3ul, 1umol / L Primer solution 3ul (SSR primer markers 399 and 425), 5u Taq DNA polymerase 0.2ul, 1-5ng template DNA; total reaction volume is 20ul, the amplification program is Denaturation at 95°C for 2 minutes, denaturation at 94°C for 45 seconds, annealing at 57°C for 45 seconds, and extension at 72°C for 60 seconds, totaling 30 cycles; extension at 72°C for 8 minutes.
[0056] (3) Preparation of the gel plate: the amplified products are subjected to non-denaturing polyacrylamide...
Embodiment 3
[0060] Example 3: Rapid identification of the purity of oil sunflower Xinkui No. 19
[0061] (1) Sunflower DNA extraction: Take the young true leaves of sunflower cultured for 1 week in a mortar, add liquid nitrogen to quickly grind it into a uniform powder, and add 500μl of a 65℃ preheated CTAB extraction kit before the sample is melted. After mixing thoroughly, transfer the sample solution into a 1.5 ml centrifuge tube, place it in a 65℃ water bath for 50 min, invert the centrifuge tube several times during this time, CTAB extraction kit uses 50 mmol / L Tris-HCl pH8, 0.7 mmol / L NaCl, 10 mmol / L EDTA, pH8, 1% CTAB, 20mmol / L 2-mercaptoethanol; take out the sample and cool to room temperature, add equal volumes of phenol / chloroform (1:1) and chloroform / isoamyl alcohol (24:1) respectively Extraction, centrifuge at 12000 r / min at 4°C for 5 min; take the supernatant and add 0.6 times the volume of isopropanol to mix, place at room temperature for 5-10 min, centrifuge at 12000 r / min f...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com