A kit for rapid identification of the purity of No. 19 oil sunflower variety
A kit and oil sunflower technology, which is applied in the field of biological kits for rapid identification of the purity of new sunflower 19 varieties, can solve the problem that there is no standard procedure for rapid biochemical or DNA molecular detection technology, and achieve the elimination of reagent configuration And specific primer screening process, stable amplification effect, efficient and accurate quality control effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: A kit for rapid identification of the purity of No. 19 oil sunflower variety
[0040] The present invention provides a kit for identifying the male parent, female parent and hybrid of Xinkui No. 19, which includes:
[0041] (1) Oil sunflower DNA rapid extraction kit A configuration: 50mmol / LTris-HClpH8, 0.7mmol / LNaCl, 10mmol / LEDTA, pH8, 1%CTAB, 20mmol / L2-mercaptoethanol.
[0042] (2) PCR amplification reaction kit B configuration: 5× reaction buffer 4ul, 25mmol / LMgCl 2 Solution 2ul, 0.1mmol / LdNTPs solution 3ul, 1umol / LPrimer solution 3ul (SSR primer markers 399 and 425), 5uTaqDNA polymerase 0.2ul.
[0043] 1-5ng template DNA; the total reaction volume is 20ul, the amplification program is denaturation at 95°C for 2min, denaturation at 94°C for 45s, annealing at 57°C for 45s, extension at 72°C for 60s, a total of 30 cycles; extension at 72°C for 8min.
[0044] Primer Mark 399:
[0045] Left sequence CGTACGGTGTAGTTCTCATGGT;
[0046] right sequence GGATCACGT...
Embodiment 2
[0052] Example 2: Rapid Identification of the Purity of Oil Sunflower No. 19 Variety
[0053] A method for quickly identifying the purity of No. 19 oil sunflower variety, the specific method steps are as follows:
[0054] (1) The oil sunflower DNA rapid extraction reagent contains 50mmol / LTris-HCl pH8, 0.7mmol / LNaCl, 10mmol / LEDTA, pH8, 1% CTAB, 20mmol / L 2-mercaptoethanol.
[0055] (2) PCR amplification reaction reagent contains 4ul of 5× reaction buffer, 25mmol / LMgCl 2 Solution 2ul, 0.1mmol / LdNTPs solution 3ul, 1umol / LPrimer solution 3ul (SSR primer markers 399 and 425), 5uTaq DNA polymerase 0.2ul, 1-5ng template DNA; the total reaction volume is 20ul, and the amplification program is denaturation at 95°C for 2min , Denaturation at 94°C for 45s, annealing at 57°C for 45s, extension at 72°C for 60s, a total of 30 cycles; extension at 72°C for 8min.
[0056] (3) Preparation of the gel plate: the amplified product was subjected to non-denaturing polyacrylamide gel electrophores...
Embodiment 3
[0060] Example 3: Rapid Identification of the Purity of Oil Sunflower No. 19 Variety
[0061] (1) Sunflower DNA extraction: Take the young true leaves of sunflower cultivated for 1 week above in a mortar, add liquid nitrogen and quickly grind them into a uniform powder, add 500 μl of CTAB extraction kit preheated at 65°C before the sample melts , after fully mixing, transfer the sample solution into a 1.5ml centrifuge tube, place it in a 65°C water bath for 50 minutes, and invert the centrifuge tube several times during this period. The CTAB extraction kit uses 50mmol / LTris-HCl pH8, 0.7mmol / LNaCl, 10mmol / LEDTA, pH8, 1% CTAB, 20mmol / L 2-mercaptoethanol; take out the sample and cool it to room temperature, add an equal volume of phenol / chloroform (1:1) and chloroform / isoamyl alcohol (24:1) for extraction, 4°C 12000r / min Centrifuge for 5 minutes; take the supernatant and add 0.6 times the volume of isopropanol to mix, place at room temperature for 5-10 minutes, centrifuge at 1200...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com