Method for knocking out mir-505 from mammal cell line

A mammalian and cell line technology, applied in the field of knocking out mir-505 in mammalian cell lines, can solve problems such as unclear specific methods

Inactive Publication Date: 2014-12-17
DONGHUA UNIV
View PDF3 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In 2010, Verduci L et al. found that miR-505 could regulate the proliferation and senescence / apoptosis of mouse embryonic fibroblasts by acting on its target ASF / SF2 (alternative splicing factor). Karni R et al. found that in many cells Transfection of ASF / SF2 in medium can activate part of the mTOR signaling pathway, but the specific way in which ASF participates in the regulation of mTOR is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out mir-505 from mammal cell line
  • Method for knocking out mir-505 from mammal cell line
  • Method for knocking out mir-505 from mammal cell line

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] (1) For the mir-505 gene, use the online sgRNA design software to design sgRNA

[0046]

[0047] sgRNA3: GC%: 52%;

[0048] sgRNA4: GC%: 43%

[0049] (2) In vitro synthesis of single-stranded nucleotide chains and formation of DNA double-stranded fragments

[0050] A. mir-505sgRNA3 insert in 41824

[0051] sgRNA3-F:5'-TTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGTAAATTGATGCACCCAGTG

[0052] sgRNA3-R:5'-ACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCACTGGGTGCATCAATTTAC

[0053] Using the PCR system, the two single-stranded nucleotides were annealed and extended into a double-stranded DNA fragment with a sequence length of 98bp, and identified by 2% agarose gel electrophoresis ( Figure 4 ). PCR system: add ddH2O 10ul, GT Buffer, 1.5ul, dNTP 1.5ul, positive and negative single-stranded (10P) 1.5ul, BSA 0.2ul, taq enzyme 1ul. PCR program: 95°C for 2min, 5 cycles of (95°C for 30sec, 56°C for 30sec, 72°C for 1min), 72°C for 10min.

[0054] mir-505sgRNA3 and mir-505sgRNA4 inser...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for knocking out mir-505 from a mammal cell line, which comprises the following steps: synthesizing an sgRNA nucleotide single chain in vitro, treating to obtain an insertion element, inserting the sgRNA into a 41824 vector or 42230 vector by homologous recombination or T4 connection, transforming into competent cells of Escherichia coli, carrying out bacterial colony PCR (polymerase chain reaction) detection and sequencing confirmation on the vector to obtain an expression vector, denaturing the PCR product, annealing to form a heterologous hybrid double chain, and determining the shear efficiency of the CRISPR-Cas9 system on the mir-505 gene by using a T7E1 enzyme digestion test. The method provides references for selecting the sgRNA expression vector.

Description

technical field [0001] The invention belongs to the field of gene knockout methods, in particular to a method for knocking out mir-505 in mammalian cell lines. Background technique [0002] In 1987, the Japanese research group discovered tandem spaced repeats near the alkaline phosphatase gene of E.coli K12. In subsequent studies, it was found that such spaced repeats widely exist in the genomes of bacteria and archaea. In 2002, , officially named by scientists as Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR). [0003] CRISPR has been found to be an immune system of bacteria and archaea, which consists of a series of short conserved repeat sequences separated by unique DNA sequences of similar size, a unique DNA sequence called a spacer, and these spacers Usually derived from phage or plasmid DNA. CRISPR columns and Cas (CRISPR-associated) genes form CRISPR-Cas adaptation to the immune system [5-7] . The function of the CRISPR / Cas system is as follow...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85
Inventor邓倩云周宇荀常雪莹王斯佳肖君华李凯
OwnerDONGHUA UNIV