Method for improving pichia pastoris recombinant expression hyaluronidase

A technology of hyaluronidase and Pichia pastoris, applied in the field of bioengineering, can solve the problem of low expression of hyaluronidase

Inactive Publication Date: 2015-01-07
JIANGNAN UNIV
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the problem that the expression level of hyaluronidase produced by recombinant Pichia pastoris is low, the present invention provides a method for improving the recombinant expression of hyaluronidase in Pichia pastoris, and obtains the recombinant Pichia pichia with improved hyaluronidase production. red yeast strain

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving pichia pastoris recombinant expression hyaluronidase
  • Method for improving pichia pastoris recombinant expression hyaluronidase
  • Method for improving pichia pastoris recombinant expression hyaluronidase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Construction of expression vector containing signal peptide hyaluronidase gene (nsB-HaseA3887)

[0024] 1. Signal peptide nsB

[0025] By PCR, a 6×His-tag tag is fused upstream of the leech hyaluronidase whose nucleotide sequence is shown in SEQ ID NO.2 to obtain the hyaluronidase gene HaseA3887. According to the sequence of the signal peptide nsB gene and the hyaluronidase Fusion primers were designed for the full-length gene sequence of HaseA3887, which were divided into three sections for fusion, and the signal peptide nsB with the nucleotide sequence shown in SEQ ID NO.1 was gradually added to the N-terminal of the HaseA3887 gene sequence. Primers were designed as follows:

[0026] nsB1:

[0027] ACTTGCGTTGCAGCCACTCCTTTGGTGAAGCGTCACCACCACCACCACATGAAAGAnsB2:

[0028] TACTCTCTCTGACCGGTGTGGCTGGTGTGCTTGCGACTTGCGTTGCAGCCACTCCTTTGnsB3:

[0029]CGCGGATCCAAACGATGAAGCTACTCTCTCTGACCGGTGTGGCT

[0030] nsB1, nsB2, and nsB3 are used as upstream primers, and the up...

Embodiment 2

[0048] Embodiment 2 Shake flask fermentation

[0049] Recombinant ɑ-factor-HaseA3887HF-pPIC9K-P.pastoris GS115 / NT-his, nsB-HaseA3887HF-pPIC9K-P.pastoris GS115 / NT-his, YTP1-HaseA3887HF-pPIC9K-P.pastoris GS115 / NT-his, HKR1 -HaseA3887HF-pPIC9K-P. pastoris GS115 / NT-his, SCS3-HaseA3887HF-pPIC9K-P. pastoris GS115 / NT-his were fermented. Single clones were inoculated in 10 mL of YPD medium (yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L), and cultured at 30°C and 200 rpm for 24 hours. Transfer to 50ml induction expression medium BMGY (yeast extract 10g / L, peptone 20g / L, 3g / L K 2 HPO 4 , 11.8g / L KH 2 PO 4 , 10×YNB100ml / L (13.4g / L), 500×biotin 1mL (4×10 -4 g / L), glycerol 10mL), cultured at 25°C 200rpm to OD 600 When the value is between 4, the thalline is collected by centrifugation, and replaced with 50ml induction expression medium BMMY (yeast extract 10g / L, peptone 20g / L, 3g / L K 2 HPO 4 , 11.8g / L KH 2 PO 4 , 100×YNB100mL / L (13.4g / L), 500×biotin 1mL (4×10 -4 g / L), met...

Embodiment 3

[0051] Example 3 Induced Expression of Recombinant Bacteria nsB-HaseA3887HF-pPIC9K-P.pastoris GS115 / NT-his on a 3L Fermenter

[0052] The recombinant nsB-HaseA3887HF-pPIC9K-P.pastoris GS115 / NT-hiss clone was expressed in fermentation culture. Single clones were inoculated in 50 mL of YPD medium (yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L), and cultured at 30°C and 200 rpm for 24 hours. Inoculated with 800mL BSM medium (85% phosphoric acid 26.7mL / L, CaSO 4 ·H 2 O0.93g / L, K 2 SO 4 18.2g / L, MgSO 4 ·7H 2 O14.9g / L, KOH4.13g / L, glycerol 40.0g / L, PTM1 4.35mL / L) 3L fermenter, the fermentation conditions are: temperature is 30 ℃, 200rpm, pH is 5.5 and is cultivated to OD 600 is 80, start feeding culture, add 12mL / LPTM1 (CuSO 4 5H 2 O 6g / L, KI0.09g / L, MnSO 4 h 2 O 3g / L, H 3 BO 3 0.02g / L, MoNa 2 o 4 2H 2 O 0.2g / L, CoCl 2 0.5g / L, ZnCl 2 20g / L, FeSO 4 7H 2 O 65g / L, Biotin 0.2g / L, H 2 SO 4 5.0mL / L) of glycerol, feed volume (mL) is as follows in Table 1:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving pichia pastoris recombinant expression hyaluronidase, and belongs to the technical field of bioengineering. A sectional signal peptide sequence is fused at the front section of recombinant hyaluronidase gene, so that the problem of low yield of the original recombinant strain is solved, and the yield of the recombinant hyaluronidase in the pichia pastoris is obviously improved. The successful establishment of engineering lays a certain foundation for further reducing the production cost of hyaluronidase of leech and widening the application range, and the pichia pastoris recombinant expression hyaluronidase is suitable for industrial production.

Description

technical field [0001] The invention relates to a method for improving the recombinant expression of hyaluronidase in Pichia pastoris, especially a method for increasing the expression yield of hyaluronidase by fusing a signal peptide signal peptide at the N-terminal of hyaluronidase, which belongs to bioengineering technology field. Background technique [0002] Hyaluronidase (Hyaluronidase, HAase) mainly hydrolyzes hyaluronic acid specifically, exists widely in eukaryotes and prokaryotes, and participates in many important biological processes in animal organisms. It was first discovered and called by Duran Reynals in 1928. As "diffusion factor", it was officially named hyaluronidase by Chain and Duthie in 1940. According to the substrate specificity and catalytic mechanism of hyaluronidase action, leech hyaluronidase belongs to the hyaluronic acid 3-glycosyl hydrolase family (EC3. bond, producing a tetrasaccharide molecule HA with glucuronic acid as the main product at ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/26C12N15/81C12N1/19C12R1/84
CPCC12N9/2474C12Y302/01035
Inventor陈坚堵国成康振张娜
OwnerJIANGNAN UNIV