Insect resistant gene mCry2Ab and application thereof
A technology of encoding gene and transgenic cell line, applied to the insect-resistant gene mCry2Ab and its application field, can solve problems such as death, and achieve the effects of reducing environmental pollution, important economic value, and reducing the amount of use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1. Obtaining the mCry2Ab gene through codon optimization
[0055] The present invention carefully studies the active region of the Cry2Ab protein (the amino acid sequence is sequence 2 in the sequence listing, and the nucleotide sequence of its coding gene Cry2Ab is sequence 3 in the sequence listing from the 1114th to 3015th nucleotide at the 5' end) Analysis, under the premise of ensuring to further improve its expression level, the Cry2Ab gene was modified according to the coding characteristics of high-expression genes in maize to obtain the mCry2Ab gene. The nucleotide sequence of this gene is sequence 1 to 5' in the sequence table. At the 1114th-3015th nucleotides at the end, the expressed protein is still the Cry2Ab protein shown in Sequence 2 in the sequence listing.
[0056] Nucleotide sequence comparison between Cry2Ab and mCry2Ab figure 1 As shown, the codon usage rate before and after transformation is shown in Table 1 below. The two have only 66% h...
Embodiment 2
[0060] Example 2, Research on insect resistance of mCry2Ab gene
[0061] 1. Construction of prokaryotic expression vector
[0062] Using the mCry2Ab shown in the artificially synthesized sequence 1 as a template, the following primer sequences were used: 2Ab1F: 5'ATGAATAGTGTATTGAATAGCGGAA 3', 2Ab1R: 5'TTAATAAAGTGGTGAAATATTAGTT 3' for PCR amplification to obtain a PCR product of 1902bp (sequence 1 from the 5' end 1114-3015 nucleotides).
[0063] PCR conditions: pre-denaturation at 95°C for 5min, denaturation at 95°C for 45s, annealing at 59°C for 45s, extension at 72°C for 2min, extension at 72°C for 10min after 32 cycles, and storage at 10°C. Reaction system: DNA 2ul, 2Ab1F 0.5ul, 2Ab1R 0.5ul, Taq 0.3ul, 10×buffer 2ul, dNTP 1.6ul, ddH2O 13.1ul, total 20ul.
[0064] Connect the above PCR product to the pEASY-E1 prokaryotic expression vector produced by Beijing Quanshijin Biotechnology Co., Ltd., detect the plasmid of the positive clone, and then sequence the plasmid of the po...
Embodiment 3
[0074] Example 3. Research on the insect resistance of transfected mCry2Ab corn
[0075] 1. Obtaining of mCry2Ab-transformed corn
[0076] 1. Construction of plant expression vectors for Cry2Ab and mCry2Ab genes
[0077] The first step: adh1Intron was amplified by PCR, Nco1 was added to the 5' end, and Spe1+BstEII restriction site was added to the 3' end, connected to the T vector of Promega, sequenced, and a positive clone T+adh1Intron was obtained;
[0078] Step 2: artificially synthesize Cry2Ab and mCry2Ab genes respectively, add a Spe1 restriction site at the 5' end, and add a BstEII restriction site at the 3' end;
[0079] Step 3: Use Nco1 and BstEII to double-digest T+adh1Intron and pCAMBIA3301 respectively, recover the target fragments and connect them to obtain pCAMBIA3301+adh1Intron;
[0080] Step 4: Digest pCAMBIA3301+adh1Intron, Cry2Ab and mCry2Ab with Spe1 and BstEII, and connect them respectively to obtain pCAMBIA3301+adh1Intron+Cry2Ab and pCAMBIA3301+adh1Intron...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com