Insect resistant gene mCry2Ab and application thereof

A technology of encoding gene and transgenic cell line, applied to the insect-resistant gene mCry2Ab and its application field, can solve problems such as death, and achieve the effects of reducing environmental pollution, important economic value, and reducing the amount of use

Active Publication Date: 2015-01-28
北京粮元生物科技有限公司
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Domestically, research on the resistance of Cry1Ab protein to armyworms has been mainly carried out. Wang Dongyan et al. (2004) and Wang Zhenying et al. (2005) have used MON810 and Bt11 to conduct resistance research on newly hatched larvae and 5th instar larvae. The results show that Cry1Ab protein is effective against armyworms. Very good control effect. All the newly hatched larvae died after 3 days of feeding, and all the 5th instar larvae died after 12 days of feeding. There is no research on other genes for armyworm resistance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Insect resistant gene mCry2Ab and application thereof
  • Insect resistant gene mCry2Ab and application thereof
  • Insect resistant gene mCry2Ab and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1. Obtaining the mCry2Ab gene through codon optimization

[0055] The present invention carefully studies the active region of the Cry2Ab protein (the amino acid sequence is sequence 2 in the sequence listing, and the nucleotide sequence of its coding gene Cry2Ab is sequence 3 in the sequence listing from the 1114th to 3015th nucleotide at the 5' end) Analysis, under the premise of ensuring to further improve its expression level, the Cry2Ab gene was modified according to the coding characteristics of high-expression genes in maize to obtain the mCry2Ab gene. The nucleotide sequence of this gene is sequence 1 to 5' in the sequence table. At the 1114th-3015th nucleotides at the end, the expressed protein is still the Cry2Ab protein shown in Sequence 2 in the sequence listing.

[0056] Nucleotide sequence comparison between Cry2Ab and mCry2Ab figure 1 As shown, the codon usage rate before and after transformation is shown in Table 1 below. The two have only 66% h...

Embodiment 2

[0060] Example 2, Research on insect resistance of mCry2Ab gene

[0061] 1. Construction of prokaryotic expression vector

[0062] Using the mCry2Ab shown in the artificially synthesized sequence 1 as a template, the following primer sequences were used: 2Ab1F: 5'ATGAATAGTGTATTGAATAGCGGAA 3', 2Ab1R: 5'TTAATAAAGTGGTGAAATATTAGTT 3' for PCR amplification to obtain a PCR product of 1902bp (sequence 1 from the 5' end 1114-3015 nucleotides).

[0063] PCR conditions: pre-denaturation at 95°C for 5min, denaturation at 95°C for 45s, annealing at 59°C for 45s, extension at 72°C for 2min, extension at 72°C for 10min after 32 cycles, and storage at 10°C. Reaction system: DNA 2ul, 2Ab1F 0.5ul, 2Ab1R 0.5ul, Taq 0.3ul, 10×buffer 2ul, dNTP 1.6ul, ddH2O 13.1ul, total 20ul.

[0064] Connect the above PCR product to the pEASY-E1 prokaryotic expression vector produced by Beijing Quanshijin Biotechnology Co., Ltd., detect the plasmid of the positive clone, and then sequence the plasmid of the po...

Embodiment 3

[0074] Example 3. Research on the insect resistance of transfected mCry2Ab corn

[0075] 1. Obtaining of mCry2Ab-transformed corn

[0076] 1. Construction of plant expression vectors for Cry2Ab and mCry2Ab genes

[0077] The first step: adh1Intron was amplified by PCR, Nco1 was added to the 5' end, and Spe1+BstEII restriction site was added to the 3' end, connected to the T vector of Promega, sequenced, and a positive clone T+adh1Intron was obtained;

[0078] Step 2: artificially synthesize Cry2Ab and mCry2Ab genes respectively, add a Spe1 restriction site at the 5' end, and add a BstEII restriction site at the 3' end;

[0079] Step 3: Use Nco1 and BstEII to double-digest T+adh1Intron and pCAMBIA3301 respectively, recover the target fragments and connect them to obtain pCAMBIA3301+adh1Intron;

[0080] Step 4: Digest pCAMBIA3301+adh1Intron, Cry2Ab and mCry2Ab with Spe1 and BstEII, and connect them respectively to obtain pCAMBIA3301+adh1Intron+Cry2Ab and pCAMBIA3301+adh1Intron...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an insect resistant gene mCry2Ab and application thereof. The invention provides application of the Cry2Ab protein, coding gene thereof or a gene expression cassette, a recombinant vector, a recombinant strain, a transgenic cell line or recombinant bacteria containing the coding gene to improvement of insect resistance of plants; and the amino acid sequence of the Cry2Ab protein is shown as the sequence 2 in the sequence table. The experiment of the invention proves that the insect resistant gene mCry2Ab is more suitable for efficient and stable expression in plant cells; the mCry2Ab is introduced into maize to obtain a stably inherited mCry2Ab transformant with corresponding anti-armyworm activity, thereby reducing the use of pesticides reducing the pollution of the environment; therefore, the invention has important economic value and broad application prospect. The mCry2Ab gene can also be transformed by bacteria or fungi to produce Bt protein through large-scale fermentation, and the mCry2Ab gene can be prepared into armyworm killing agent used for the prevention and control of crop pests.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an insect-resistant gene mCry2Ab and its application. Background technique [0002] As the population continues to grow, the area of ​​arable land is decreasing, and the problem of food security is becoming more and more prominent. It is particularly urgent to continue to increase food production, and insect pests are one of the important factors that cause agricultural production and quality decline. Therefore, a long time ago, people used Committed to finding an ideal pest control method. In the 1940s, due to the development of the chemical industry, organic pesticides were artificially synthesized, and chemical pesticides became the main means of pest control of crops for a while. However, after a long period of unreasonable use in large quantities, not only did not completely control the harm of pests, but instead produced the 3R problems of pest resistance (Resistan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/32C07K14/325C12N15/82A01N63/02A01P7/04C12N1/21C12N1/15C12N1/19A01H5/00
Inventor 赖锦盛赵海铭宋伟彬崔阳
Owner 北京粮元生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap