Fluorescence PCR detection kit for human K-RAS gene mutation

A detection kit and kit technology, applied in the field of fluorescent PCR detection kits for human K-RAS gene mutation, to achieve good specificity and strong anti-interference ability

Inactive Publication Date: 2015-04-22
SANSURE BIOTECH INC
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The purpose of the present invention is to solve the defects of the existing human K-RAS gene mutation fluorescence PCR detection kit, and provide a human K-RAS gene mutation fluorescence PCR detection kit with fast operation, simple and convenient method, high detection sensitivity and wide detection range

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescence PCR detection kit for human K-RAS gene mutation
  • Fluorescence PCR detection kit for human K-RAS gene mutation
  • Fluorescence PCR detection kit for human K-RAS gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] This embodiment provides a specific human K-RAS gene mutation nucleic acid detection kit, which includes the following components.

[0032] ①Internal standard (positive internal control): The internal standard used in the present invention is the housekeeping gene β-actin in human genomic DNA to prevent false negatives caused by PCR interference substances that may exist in the sample or the sample nucleic acid concentration is too low; The target sequence is as follows:

[0033] 5’-AAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGAC-3’;

[0034] ②PCR reaction solution: This kit includes 7 PCR reaction solutions to detect Gly12Asp, Gly12Val, Gly12Ser, Gly12Cys, Gly12Ala, Gly12Arg, and Gly13Asp, a total of 7 mutations.

[0035] Gly12Asp mutation detection reaction solution: 10×PCR reaction buffer 5μl, 0.2mmol / L deoxyribonucleoside triphosphate, 0.2μmol / L~0.4μmol / L upstream and downstream primer K-M1 ...

Embodiment 2

[0053] This embodiment provides an operating method for detecting the mutation of the K-RAS gene in the nucleic acid sample extracted from the paraffin section using the human K-RAS gene mutation nucleic acid detection kit described in Embodiment 1.

[0054] 1. Reagent preparation (in the reagent preparation area)

[0055] Take out the components in the packaging box, place them at room temperature, wait for their temperature to equilibrate to room temperature, mix well and set aside;

[0056] According to the number of samples to be tested, negative control, and positive control, proportionally (Gly12Asp mutation detection reaction solution 43μl / person + enzyme mixture 2μl / person; Gly12Val mutation detection reaction solution 43μl / person + enzyme mixture 2μl / person; Gly12Ser mutation detection reaction solution 43μl / person + enzyme mixture 2μl / person; Gly12Cys mutation detection reaction solution 43μl / person + enzyme mixture 2μl / person; Gly12Ala mutation detection reaction Gly12Arg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fluorescence PCR detection kit for human K-RAS gene mutation. The kit comprises a forward primer sequence K-M1 PCR reaction solution, a forward primer sequence K-M2 PCR reaction solution, a forward primer sequence K-M3 PCR reaction solution, a forward primer sequence K-M4 PCR reaction solution, a forward primer sequence K-M5 PCR reaction solution, a forward primer sequence K-M6 PCR reaction solution and a forward primer sequence K-M7 PCR reaction solution which are used for detecting Gly12Asp mutation, Gly12Val mutation, Gly12Ser mutation, Gly12Cys mutation, Gly12Ala mutation, Gly12Arg mutation and Gly13Asp mutation on a codon 12 and codon 13. According to the kit, under the 100ng / reaction wild-type human DNA background, amplification signals and the false positive condition are avoided, and it shows that the kit is good in specificity and high in antijamming capability. By the adoption of the kit, human K-RAS gene mutation in samples such as clinical paraffin sections can be detected quickly, and a reliable experiment basis is provided for diagnosing related cancer therapies.

Description

Technical field [0001] The invention provides a fluorescent PCR detection kit for human K-RAS gene mutation. Background technique [0002] Clinically, the targeted drugs Erbitux (Cetuximab) and Panitumumab (Panitumumab) are only suitable for wild-type patients with K-RAS gene without mutation, and are not effective for patients with K-RAS mutation. The National Comprehensive Cancer Network (NCCN) included the K-RAS test in the "Clinical Treatment Guidelines for Colon Cancer." [0003] The K-RAS gene is a recognized oncogene. The results of clinical studies were released at the American Society of Clinical Oncology (ASCO) annual meeting as early as June 2008, that is, patients with K-RAS mutants do not benefit from anti-EGFR treatment, but instead This increases the risk of adverse reactions and the cost of treatment; and K-RAS wild-type patients are likely to benefit from such drug treatment. In October of the same year, the K-RAS gene mutation test was written into the latest ed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6886C12Q2600/118C12Q2600/156C12Q2600/16
Inventor戴立忠吴康龙凤英高堂杰
OwnerSANSURE BIOTECH INC