Primer of snoRNA genetic molecular markers for screening drought-resistant rice varieties
A molecular marker and variety technology, applied in the direction of DNA/RNA fragment, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem of little understanding of the role, avoid screening bias, wide practical value, reduce screening workload Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0017] The following is a method for screening drought-tolerant varieties using molecular markers of rice snoRNA genes, and its specific implementation steps are as follows:
[0018] 1. Primer design
[0019] Primers were designed according to the Oryza sativa Z257snoRNA gene sequence, the primer sequence:
[0020] Forward primer: 5'CACCCGTTTCAACTCCACGC3',
[0021] Reverse primer 5'TCAGGGCGAAGACTGGATGG3'
[0022] 2. PCR reaction system
[0023] 25 μl reaction system for amplification, including 1 μl primer, 1 μl template, 0.3 μl Tap enzyme, 2 μl DNTP, 2.5 μl buffer, Mg 2+ 2 μl, double distilled water 15.2 μl, a total of 25 μl.
[0024] The cycle parameters were pre-denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 s, renaturation at 55°C for 50 s, extension at 72°C for 60 s, and 35 cycles of extension at 72°C for 5 min.
[0025] 3. Detection example
[0026] (1) Drought treatment
[0027] Get river sand and soil after drying (dryin...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com