Primer of snoRNA genetic molecular markers for screening drought-resistant rice varieties

A molecular marker and variety technology, applied in the direction of DNA/RNA fragment, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem of little understanding of the role, avoid screening bias, wide practical value, reduce screening workload Effect

Inactive Publication Date: 2015-04-29
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although snoRNA genes play an important role in plant life activities, little is known about their role in plant stress

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer of snoRNA genetic molecular markers for screening drought-resistant rice varieties

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0017] The following is a method for screening drought-tolerant varieties using molecular markers of rice snoRNA genes, and its specific implementation steps are as follows:

[0018] 1. Primer design

[0019] Primers were designed according to the Oryza sativa Z257snoRNA gene sequence, the primer sequence:

[0020] Forward primer: 5'CACCCGTTTCAACTCCACGC3',

[0021] Reverse primer 5'TCAGGGCGAAGACTGGATGG3'

[0022] 2. PCR reaction system

[0023] 25 μl reaction system for amplification, including 1 μl primer, 1 μl template, 0.3 μl Tap enzyme, 2 μl DNTP, 2.5 μl buffer, Mg 2+ 2 μl, double distilled water 15.2 μl, a total of 25 μl.

[0024] The cycle parameters were pre-denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 s, renaturation at 55°C for 50 s, extension at 72°C for 60 s, and 35 cycles of extension at 72°C for 5 min.

[0025] 3. Detection example

[0026] (1) Drought treatment

[0027] Get river sand and soil after drying (dryin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer of snoRNA genetic molecular markers for screening drought-resistant rice varieties. The primer comprises a forward primer with a nucleotide sequence shown as SEQ ID NO:1 and a reverse primer with a nucleotide sequence shown as SEQ ID NO:2. The drought-resistant varieties can be rapidly and accurately screened by utilizing the molecular markers, specifically, when the drought-resistant varieties are subjected to amplification by using the markers, a clear strip is amplified, while the strip does not occur when drought-sensitive varieties are subjected to amplification by using the markers, so that whether the varieties are drought-resistant can be identified, and the screening result of the marker is consistent with the drought-resistant varieties screened after drought treatment. Therefore, the marker can be effectively used for screening the drought-resistant varieties. When the drought-resistant varieties are screened by utilizing the marker, the screening time can be greatly shortened, the screening step is simplified, and the screening efficiency is improved.

Description

technical field [0001] The invention relates to the field of rice genetic engineering, in particular to a primer for screening snoRNA gene molecular markers of rice drought-tolerant varieties. Background technique [0002] Water shortage is a global problem currently restricting agricultural production. About 43% of the world's arable land is in arid and semi-arid areas. Drought stress seriously affects the growth and development of plants, resulting in crop yield reduction. my country is a water-poor country, and the contradiction between supply and demand of water resources is very sharp. In recent years, water shortage will be one of the most serious problems facing our country. Moreover, in agricultural production, frequent droughts often occur, causing huge losses to food production. The annual loss of food production caused by drought in the world is almost equal to the sum of losses caused by all other environmental factors. [0003] Small nucleolar RNA (snoRNA) is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13
Inventor 马廷臣李泽福夏加发王元垒周坤能
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap