Antitumor polypeptide for targeted inhibition on ERK signal channel and application of antitumor polypeptide
A tumor and inhibitor technology, applied in the field of molecular biology and biomedicine, can solve the problem of unclear negative feedback regulation mechanism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Construction of pCMV-P2SE plasmid
[0031] see figure 2 , using the GST-PULL technique to identify the amino acid sequence of the FOXO1 fragment that binds to the CC domain of the scaffold protein IQGAP1: NDDFDNWSTFRPRTS S NASTISGRLSPIMT (SEQ ID NO. 1). Utilize the pCMV-HA vector (purchased from Clontech Company, vector map see image 3 ) to construct a plasmid expressing the sequence, and mutate the serine (S) point at the 319th position to glutamic acid (E) to achieve the purpose of simulating the phosphorylation state, namely: NDDFDNWSTFRPRTS E NASTISGRLSPIMT (SEQ ID NO. 2). We named the constructed plasmid pCMV-P2SE, and the expressed polypeptide (sequence shown in SEQ ID NO.2) was named P2SE.
[0032] The construction method of the pCMV-P2SE plasmid is as follows: the pCMV-HA vector is digested with EcoR I and Xho I enzymes, and the expression sequence of P2SE (CTATTTATTAAAATTACTAACCTCATGAAAAGCAG GAGCATGATCACTTCTACGATCATGATAATCACCAGCAAATTCAGGATAATACT...
Embodiment 2
[0033] Example 2 P2SE inhibits the activation of the ERK signaling pathway caused by MK2206 in prostate cancer cells
[0034] The pCMV-P2SE plasmid was transfected in the prostate cancer cells LNCaP, and the P2SE polypeptide was expressed in the cells. The results showed that p-AKT was inhibited and p-ERK was significantly increased in LNCaP cells treated with MK2206; however, p-ERK was not activated while p-AKT was inhibited in cells transfected with P2SE polypeptide. At the same time, the cells were treated with CHX to exclude the above-mentioned effects caused by the nuclear transcription function of P2SE. See Figure 4 .
Embodiment 3
[0035] Example 3 P2SE reverses the resistance of prostate cancer cells to MK2206
[0036] The pCMV-P2SE plasmid was transfected in the prostate cancer cells LNCaP, and the P2SE polypeptide was expressed in the cells, and the MTS experiment was performed to detect the proliferation activity of the LNCaP cells. The result is as Figure 5 As shown, cells treated with MK2206 alone reappeared a rebound in cell proliferation after undergoing a transient cytostatic suppression; whereas in cells expressing P2SE, cell proliferation was continuously inhibited after MK2206 treatment.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap