Check patentability & draft patents in minutes with Patsnap Eureka AI!

Antitumor polypeptide for targeted inhibition on ERK signal channel and application of antitumor polypeptide

A tumor and inhibitor technology, applied in the field of molecular biology and biomedicine, can solve the problem of unclear negative feedback regulation mechanism

Inactive Publication Date: 2015-05-13
XIN HUA HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the negative feedback regulation mechanism between AKT and ERK signaling pathways is still unclear, and there are no reports on the use of PI3K / AKT inhibitors in anti-tumor therapy to improve the efficacy of drug therapy by inhibiting ERK signaling pathways.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antitumor polypeptide for targeted inhibition on ERK signal channel and application of antitumor polypeptide
  • Antitumor polypeptide for targeted inhibition on ERK signal channel and application of antitumor polypeptide
  • Antitumor polypeptide for targeted inhibition on ERK signal channel and application of antitumor polypeptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of pCMV-P2SE plasmid

[0031] see figure 2 , using the GST-PULL technique to identify the amino acid sequence of the FOXO1 fragment that binds to the CC domain of the scaffold protein IQGAP1: NDDFDNWSTFRPRTS S NASTISGRLSPIMT (SEQ ID NO. 1). Utilize the pCMV-HA vector (purchased from Clontech Company, vector map see image 3 ) to construct a plasmid expressing the sequence, and mutate the serine (S) point at the 319th position to glutamic acid (E) to achieve the purpose of simulating the phosphorylation state, namely: NDDFDNWSTFRPRTS E NASTISGRLSPIMT (SEQ ID NO. 2). We named the constructed plasmid pCMV-P2SE, and the expressed polypeptide (sequence shown in SEQ ID NO.2) was named P2SE.

[0032] The construction method of the pCMV-P2SE plasmid is as follows: the pCMV-HA vector is digested with EcoR I and Xho I enzymes, and the expression sequence of P2SE (CTATTTATTAAAATTACTAACCTCATGAAAAGCAG GAGCATGATCACTTCTACGATCATGATAATCACCAGCAAATTCAGGATAATACT...

Embodiment 2

[0033] Example 2 P2SE inhibits the activation of the ERK signaling pathway caused by MK2206 in prostate cancer cells

[0034] The pCMV-P2SE plasmid was transfected in the prostate cancer cells LNCaP, and the P2SE polypeptide was expressed in the cells. The results showed that p-AKT was inhibited and p-ERK was significantly increased in LNCaP cells treated with MK2206; however, p-ERK was not activated while p-AKT was inhibited in cells transfected with P2SE polypeptide. At the same time, the cells were treated with CHX to exclude the above-mentioned effects caused by the nuclear transcription function of P2SE. See Figure 4 .

Embodiment 3

[0035] Example 3 P2SE reverses the resistance of prostate cancer cells to MK2206

[0036] The pCMV-P2SE plasmid was transfected in the prostate cancer cells LNCaP, and the P2SE polypeptide was expressed in the cells, and the MTS experiment was performed to detect the proliferation activity of the LNCaP cells. The result is as Figure 5 As shown, cells treated with MK2206 alone reappeared a rebound in cell proliferation after undergoing a transient cytostatic suppression; whereas in cells expressing P2SE, cell proliferation was continuously inhibited after MK2206 treatment.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antitumor polypeptide for targeted inhibition on an ERK signal channel and application of the antitumor polypeptide. According to the antitumor polypeptide, a micro-molecule polypeptide for targeted inhibition on the ERK signal channel is established; a series of biological experiment shows that the micro-molecule polypeptide is capable of effectively inhibiting drug resistance of a PI3K / AKT inhibitor or a paclitaxel medicine in the antitumor treatment process for multiple tumors such as prostate cancer, breast cancer, colon cancer and rectal cancer, and has a remarkable synergic antitumor function; as the ERK signal channel exists in multiple tumors and is one of important signal channels for promoting cell growth and tumor generation and development, the micro-molecule polypeptide can be used for treating the tumors, and preferably the micro-molecule polypeptide is used together with the PI3K / AKT inhibitor or the paclitaxel medicine.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and biomedicine, in particular to an anti-tumor polypeptide capable of targeting and inhibiting the ERK signaling pathway and its application. Background technique [0002] Phosphatidylinositol 3-kinase / protein kinase B (PI3K / AKT) is one of the most important signaling pathways found to promote cell growth and tumorigenesis and development. Therefore, many preclinical or clinical drugs are being used, including Chemotherapy drugs and targeted therapy drugs have been designed or proven to achieve anti-tumor effects by inhibiting the AKT signaling pathway. [0003] However, it has been found that such drugs often produce drug resistance and become ineffective after a good initial anti-tumor effect. Our study found that after treating prostate cancer cells with PI3K / AKT inhibitors, such as MK2206 and NVP-BEZ235, although it can significantly inhibit the activation of AKT, it will cause ex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/00C12N15/11A61K38/16A61K48/00A61P35/00
CPCA61K38/00A61K48/00C07K14/00
Inventor 潘春武
Owner XIN HUA HOSPITAL AFFILIATED TO SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More