New (R)-transaminase from Fusarium oxysporum and application thereof

A transaminase and amino acid technology, applied in the field of new-transaminase and its application in the production of chiral amines and unnatural amino acids, can solve problems such as transaminases that do not yet exist

Inactive Publication Date: 2015-05-20
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report of (R)-transaminase in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • New (R)-transaminase from Fusarium oxysporum and application thereof
  • New (R)-transaminase from Fusarium oxysporum and application thereof
  • New (R)-transaminase from Fusarium oxysporum and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The preparation method of embodiment one new (R)-transaminase HFO

[0029] (1) Construction of engineering bacteria: The coding gene (SEQ NO.1) of the new (R)-transaminase HFO was amplified from the genomic DNA of Fusarium oxysporum Fo5176 by PCR technology (6×His-tag was added to the N-terminal In order to purify the target protein (HFO) with a nickel affinity column, the upstream primer is: catg CCATGG CTCACCATCATCATCATCACATGGCAACTATGGACGAGG, the downstream primer is ccc AAGCTTCTACTAGTAATCAATCTTGAAGCTGAACTC, the obtained PCR fragment was inserted into the pET28a expression vector at the Nco I / Hind III site after double digestion. The recombinant plasmid is transferred into the host bacterial cell (preferably Escherichia coli BL21 (DE3)), and the corresponding engineering strain is obtained.

[0030] (2) Expression and purification: LB medium was used to culture in a shaker at 37°C until logarithmic phase, and after cooling to 25°C, IPTG with a final concentration ...

Embodiment 2

[0032] The enzymatic property of embodiment two new (R)-transaminase HFO

[0033] The optimum pH value, optimum reaction temperature and temperature stability of the new (R)-transaminase HFO were examined.

[0034] Simple reaction formula: .

[0035] Activity assay reaction system: 1 ml of pH buffer, PLP (20 μM), (R)-1-phenylethylamine (10 mM), pyruvic acid (10 mM). The reaction was initiated by adding an appropriate amount of neo(R)-transaminase HFO and terminated with perchloric acid after half an hour of reaction. After the reaction was terminated, the amount of acetophenone generated by the reaction was determined by HPLC to determine the size of the enzyme activity.

[0036] Determination of the optimum reaction pH value: use the bioassay reaction system, the reaction temperature is 30°C, and measure at a series of different pH values ​​(pH=5, 6, 7, 7.4, 7.8, 8, 8.4, 8.8, 9, 9.4, 9.6 , 10) The enzymatic activity of the new (R)-transaminase HFO. The buffers used in d...

Embodiment 3

[0040] Substrate spectrum and application of embodiment three new (R)-transaminase HFO

[0041] (1) Amino donor substrate spectrum of the new (R)-transaminase HFO.

[0042] Simple Reaction Formula: Amino Donor (Table 3)

[0043] Reaction conditions: 1ml of reaction system. Add pyridoxal phosphate (20μM), amino donor substrate (10mM, racemate 20mM) and pyruvate (10mM) into sodium phosphate buffer (100mM, pH7.4), mix well and add appropriate amount of HFO enzyme solution Start the reaction, react in a 30°C water bath for 30 minutes, and then terminate the reaction with 375ul of 16% perchloric acid.

[0044] Calculation of relative activity: Calculate the relative activity of each substrate by detecting the decrease of pyruvate in the reaction system. The liquid phase detection conditions of pyruvate are: Aminex HPX-87H column (Bio-Rad, USA), column temperature 45 ° C, with 5 mM H 2 SO 4 As the mobile phase, the flow rate is 0.6ml / min, and the ultraviolet absorption value ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a new (R)-transaminase and application thereof. The (R)-transaminase derives from Fusarium oxysporum Fo5176 (named HFO), the gene nucleotide sequence is shown as SEQ ID No.1 and the amino acid sequence is shown as SEQ ID No.2. The new (R)-transaminase HFO is a strict (R) stereoselective Omega-transaminase, has a broad substrate spectrum, and has great application potential in bio-production of chiral amines and unnatural amino acids.

Description

technical field [0001] The invention relates to the field of biocatalysis, and mainly relates to a new (R)-transaminase derived from Fusarium oxysporum and its application in the production of chiral amines and unnatural amino acids. Background technique [0002] Chiral amines and unnatural amino acids have a wide range of applications in high value-added fields such as medicine, food, and cosmetics. For example (R)-4-phenylbutyl-2-amine (precursor of antihypertensive drug Dilevalol), phenylisoserine (β-amino acid, side chain moiety of anticancer drug paclitaxel) and cispentacin (cyclic β- Amino acids, antifungal drugs) are all key intermediates or key chiral modules for drug synthesis, and unnatural amino acids such as D-alanine are increasingly used in advanced cosmetics. In addition, studies have shown that peptides containing unnatural amino acids are more stable to protease degradation than natural peptides and still retain their biological activity. This shows that u...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P41/00C12P13/00C12P13/06C12P13/04C12R1/77
CPCC12N9/1096C12P13/001C12P13/04C12P13/06C12P41/00
Inventor朱敦明姜进举陈曦吴洽庆冯进辉马延和
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI