Method for high-resolution genotyping of SSR (simple sequence repeats) molecular marker

A molecular marker and genotyping technology, applied in the field of molecular biology, can solve problems such as large labor force, low resolution, and increased cost

Inactive Publication Date: 2015-06-03
KUNMING INST OF BOTANY - CHINESE ACAD OF SCI
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These reports are generally only suitable for the design of a small amount of SSR-labeled PCR primers, because the technical parameters for designing PCR primers are relatively loose, and PCR primers often need to optimize the reaction conditions of each pair of PCR primers repeatedly during application; detection is often by gel electrophoresis methods, resulting in low resolution, large labor force, and low efficiency (Tong et al.2012)
Bindler et al. used fluorescent labeling and sequencer detection to detect SSR fragments, which greatly improved the detection efficiency (Bindler et al.2011; Bindler et al.2007); however, each SSR marker required fluorescence to label one of the primers individually, thereby increasing the cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for high-resolution genotyping of SSR (simple sequence repeats) molecular marker
  • Method for high-resolution genotyping of SSR (simple sequence repeats) molecular marker
  • Method for high-resolution genotyping of SSR (simple sequence repeats) molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] The following steps specifically describe the present invention from the design of SSR molecular markers, PCR formula, PCR reaction program, genotyping detection and data analysis based on sequencer:

[0020] (1). Design of three primers for SSR molecular markers

[0021] The present invention requires three primers: a universal fluorescent label primer, a tailed forward primer and a reverse primer. Universal fluorescent label primers are public primers, suitable for any PCR reaction in this method, and used in conjunction with tailed forward primers and reverse primers. The sequence of the fluorescent-labeled primer is fixed as CGTTGTAAAACGACGGCCAGT, and a fluorescent label needs to be added at the 5' end during primer synthesis. Optional fluorescent markers are any fluorescent reagents that can be recognized by ABI sequencers such as FAM, HEX, and TAMRA. Wherein, the choice of fluorescence cannot be the same as the fluorescence of the reference DNA molecule used for...

Embodiment 2

[0036] a. DNA extraction

[0037] Five kinds of tobacco including tobacco forest, tobacco downy, HD tobacco and K326 tobacco were used as test samples. DNeasy Plant Mini Kit kit was used to extract the total DNA of each tobacco. The extraction method follows the steps provided in the kit, and finally dissolves the DNA to 50ul. Nanodrop detects DNA concentration. The concentration of DNA was diluted with redistilled water to a concentration of 30‐50ng / ul.

[0038] b. Design of three primers

[0039] According to the method described in Example 1, primers were designed using the online primer3 software and OligoAnalyzer 3.1. The sequences of the three designed primers are: 1. The tailed forward primer with the name xm8 is:

[0040] CGTTGTAAAACGACGGCCAGTCACTCGCAGTTTCTCTGCAC; 2. The reverse primer is:

[0041] ACCTCGAAAATCACCACCAG. 3. The sequence of the fluorescent labeling primer is: 5'FAM-

[0042] CGTTGTAAAACGACGGCCAGT. The designed primers were synthesized by Shangha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for high-resolution genotyping of an SSR (simple sequence repeats) molecular marker. According to the method, PCR (polymerase chain reaction) amplification is simultaneously carried out by virtue of three primers in a same reaction system. The invention provides a method for designing three primers, a corresponding PCR formula, a detection method for PCR circle parameters and segment parting based on a sequencer. A primer design method for genotyping of which the resolution ratio is at a nucleotide level is provided. A specific formula of a PCR reagent and PCR circle parameters are unified. The experiment process does not need to be optimized. In addition, the problem of large noise of genotyping of the SSR molecular marker based on the sequencer is solved. The method is suitable for SSR marker development of kinds of species DNAs and high-throughput and high-resolution DNA fragment parting. With a tobacco SSR molecular marker as an example, the application of the method is tested.

Description

technical field [0001] The invention belongs to the field of molecular biology and relates to a high-resolution method for SSR molecular marker genotyping based on a sequencer. Background technique [0002] In the biological genome sequence, there is a DNA sequence composed of several bases as repeating units and arranged in series. The English abbreviation is SSR (simple sequence repeats), also known as microsatellite (Ellegren 2004; Sharma2007). The characteristic of SSR sequence is that there are heritable polymorphisms among varieties, and it is the most important link discovered since this century that can link genome sequence and trait quality genes and molecular breeding (Sharma 2007; Xu and Crouch 2008). SSR sequence is one of the most ideal sequences for developing molecular markers, and is widely used in the study of genetic and evolutionary relationships of object varieties, map-based cloning of genes in reverse genetics, QTL mapping of traits, and molecular breed...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q1/686C12Q2525/151
Inventor王学文
OwnerKUNMING INST OF BOTANY - CHINESE ACAD OF SCI