Method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A HIV-1, lymphocyte technology, applied in the field of genetic engineering and antiviral infection, can solve the problem of difficult to transduce hematopoietic cells
Active Publication Date: 2015-06-10
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 24 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
However, conventional Ad5-type adenoviruses are difficult to t
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
example 1
[0050] Example 1. Preparation method of Ad5F35 chimeric adenovirus carrying CRISPR / Cas9
[0051] 1. sgRNA design and screening
[0052] 1) Using CCR5ORF as a template, use online tools to design sgRNA sequences, select the top 20 sequences with the highest scores, and optimize according to the target site, number of mismatched bases, and mismatched positions, etc., to obtain 8 sgRNA sequences ( sgR5-3 to sgR5-10); sgR5-1 and sgR5-2 are two sequences that have been reported earlier and are used as positive controls; at the same time, a non-targeting sgRNA (sgNeg) is designed as a negative control.
[0053] The sgRNA sequence information is shown in Table 1:
[0054] Table 1: Designed sgRNA sequences
[0055] name
Score
Sequence (5'-3')
Location
+ / -chain
sgR5-1
69
GCTGCCGCCCAGTGGGACTTTGG
268-287
+
[0056] sgR5-2
56
GGCAGCATAGTGAGCCCAGAAGG
254-273
-
sgR5-3
95
TCAGTTTACACCCGATCCACT...
example 2
[0115] Example 2: Application of Ad5F35 Adenovirus Carrying CRISPR / Cas9 in Inhibiting HIV-1 Infection
[0116] 1. CD4 + Isolation and culture of T lymphocytes
[0117] 1) Collect peripheral blood from healthy volunteers by venipuncture, add anticoagulant, and temporarily store at 4°C for no more than 8 hours.
[0118] 2) Add an equal volume of PBS to the anticoagulated blood and mix well. Add lymphocyte separation solution (equilibrated to room temperature) and about 2 times the volume of diluted anticoagulant blood into the centrifuge tube successively, centrifuge at 800×g at 22°C for 30 minutes without brake.
[0119]3) Aspirate the second gray-white lymphocyte layer, add at least 3 times the volume of D-Hanks buffer (recipe as follows), and centrifuge at 300×g, 10° C. for 10 minutes. D-Hanks was repeatedly washed 3 to 5 times to obtain PBMCs.
[0120] D-Hanks Buffer Recipe:
[0121]
[0122] Add 1L double distilled water to dissolve, high temperature sterilization, ...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9 and relates to genetic engineering and an anti-virus infection technology. According to the method, by utilizing the latest CRISPR/Cas9 nuclease system, through the combination of Ad5F35 mosaic type adenovirus vectors of efficient targeted primary T lymphocyte, by editing CCR5 expression of human CD4+T lymphocyte, HIV-1 virus infection is effectively inhibited. According to the method, the CRISPR/Cas9 system is packaged by utilizing the Ad5F35 type adenovirus vectors, the advantages of the CRISPR/Cas9 system and the Ad5F35 type adenovirus vectors are organically combined, the novel method for resisting HIV-1 virus infection is provided, and the method has the potential for being applied for HIV-1 gene treatment research; meanwhile, the Ad5F35 type adenovirus vectors carrying with the CRISPR/Cas9 system can be used for conducting targeted editing to other genes in the primary lymphocyte or gene editing research of other hematopoietic system cells.
Description
technical field [0001] The invention relates to genetic engineering and anti-virus infection technology, in particular to a method for inhibiting HIV-1 from infecting primary lymphocytes by using CRISPR / Cas9. Specifically, the present invention uses Ad5F35 recombinant adenovirus expressing CRISPR / Cas9 nuclease system to target edit human primary CD4 + The HIV-1 co-receptor CCR5 on the surface of T lymphocytes destroys the CCR5 expression box or makes CCR5 lose its receptor function, thereby inhibiting HIV-1 virus infection. Background technique [0002] Since it was first reported in 1984 that HIV-1 was the cause of AIDS (AIDS), a large number of top scientists around the world have devoted themselves to overcoming this disease. Ways such as therapy have significantly improved the quality of life of HIV-1 infected patients and greatly reduced the number of new HIV-1 infections; however, there is still a lack of effective vaccines and therapeutics that can cure HIV-1 infecti...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more