Method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9
A HIV-1, lymphocyte technology, applied in the field of genetic engineering and antiviral infection, can solve the problem of difficult to transduce hematopoietic cells
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
example 1
[0050] Example 1. Preparation method of Ad5F35 chimeric adenovirus carrying CRISPR / Cas9
[0051] 1. sgRNA design and screening
[0052] 1) Using CCR5ORF as a template, use online tools to design sgRNA sequences, select the top 20 sequences with the highest scores, and optimize according to the target site, number of mismatched bases, and mismatched positions, etc., to obtain 8 sgRNA sequences ( sgR5-3 to sgR5-10); sgR5-1 and sgR5-2 are two sequences that have been reported earlier and are used as positive controls; at the same time, a non-targeting sgRNA (sgNeg) is designed as a negative control.
[0053] The sgRNA sequence information is shown in Table 1:
[0054] Table 1: Designed sgRNA sequences
[0055] name
Score
Sequence (5'-3')
Location
+ / -chain
sgR5-1
69
GCTGCCGCCCAGTGGGACTTTGG
268-287
+
[0056] sgR5-2
56
GGCAGCATAGTGAGCCCAGAAGG
254-273
-
sgR5-3
95
TCAGTTTACACCCGATCCACT...
example 2
[0115] Example 2: Application of Ad5F35 Adenovirus Carrying CRISPR / Cas9 in Inhibiting HIV-1 Infection
[0116] 1. CD4 + Isolation and culture of T lymphocytes
[0117] 1) Collect peripheral blood from healthy volunteers by venipuncture, add anticoagulant, and temporarily store at 4°C for no more than 8 hours.
[0118] 2) Add an equal volume of PBS to the anticoagulated blood and mix well. Add lymphocyte separation solution (equilibrated to room temperature) and about 2 times the volume of diluted anticoagulant blood into the centrifuge tube successively, centrifuge at 800×g at 22°C for 30 minutes without brake.
[0119]3) Aspirate the second gray-white lymphocyte layer, add at least 3 times the volume of D-Hanks buffer (recipe as follows), and centrifuge at 300×g, 10° C. for 10 minutes. D-Hanks was repeatedly washed 3 to 5 times to obtain PBMCs.
[0120] D-Hanks Buffer Recipe:
[0121]
[0122] Add 1L double distilled water to dissolve, high temperature sterilization, ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap