Method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9

A HIV-1, lymphocyte technology, applied in the field of genetic engineering and antiviral infection, can solve the problem of difficult to transduce hematopoietic cells

Active Publication Date: 2015-06-10
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF0 Cites 24 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, conventional Ad5-type adenoviruses are difficult to transduce including CD4 + Hematopoietic cells including T cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9
  • Method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9
  • Method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR/Cas9

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0050] Example 1. Preparation method of Ad5F35 chimeric adenovirus carrying CRISPR / Cas9

[0051] 1. sgRNA design and screening

[0052] 1) Using CCR5ORF as a template, use online tools to design sgRNA sequences, select the top 20 sequences with the highest scores, and optimize according to the target site, number of mismatched bases, and mismatched positions, etc., to obtain 8 sgRNA sequences ( sgR5-3 to sgR5-10); sgR5-1 and sgR5-2 are two sequences that have been reported earlier and are used as positive controls; at the same time, a non-targeting sgRNA (sgNeg) is designed as a negative control.

[0053] The sgRNA sequence information is shown in Table 1:

[0054] Table 1: Designed sgRNA sequences

[0055] name

Score

Sequence (5'-3')

Location

+ / -chain

sgR5-1

69

GCTGCCGCCCAGTGGGACTTTGG

268-287

+

[0056] sgR5-2

56

GGCAGCATAGTGAGCCCAGAAGG

254-273

-

sgR5-3

95

TCAGTTTACACCCGATCCACT...

example 2

[0115] Example 2: Application of Ad5F35 Adenovirus Carrying CRISPR / Cas9 in Inhibiting HIV-1 Infection

[0116] 1. CD4 + Isolation and culture of T lymphocytes

[0117] 1) Collect peripheral blood from healthy volunteers by venipuncture, add anticoagulant, and temporarily store at 4°C for no more than 8 hours.

[0118] 2) Add an equal volume of PBS to the anticoagulated blood and mix well. Add lymphocyte separation solution (equilibrated to room temperature) and about 2 times the volume of diluted anticoagulant blood into the centrifuge tube successively, centrifuge at 800×g at 22°C for 30 minutes without brake.

[0119]3) Aspirate the second gray-white lymphocyte layer, add at least 3 times the volume of D-Hanks buffer (recipe as follows), and centrifuge at 300×g, 10° C. for 10 minutes. D-Hanks was repeatedly washed 3 to 5 times to obtain PBMCs.

[0120] D-Hanks Buffer Recipe:

[0121]

[0122] Add 1L double distilled water to dissolve, high temperature sterilization, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for inhibiting HIV-1 infectious agent from infecting primary lymphocyte by utilizing CRISPR / Cas9 and relates to genetic engineering and an anti-virus infection technology. According to the method, by utilizing the latest CRISPR / Cas9 nuclease system, through the combination of Ad5F35 mosaic type adenovirus vectors of efficient targeted primary T lymphocyte, by editing CCR5 expression of human CD4+T lymphocyte, HIV-1 virus infection is effectively inhibited. According to the method, the CRISPR / Cas9 system is packaged by utilizing the Ad5F35 type adenovirus vectors, the advantages of the CRISPR / Cas9 system and the Ad5F35 type adenovirus vectors are organically combined, the novel method for resisting HIV-1 virus infection is provided, and the method has the potential for being applied for HIV-1 gene treatment research; meanwhile, the Ad5F35 type adenovirus vectors carrying with the CRISPR / Cas9 system can be used for conducting targeted editing to other genes in the primary lymphocyte or gene editing research of other hematopoietic system cells.

Description

technical field [0001] The invention relates to genetic engineering and anti-virus infection technology, in particular to a method for inhibiting HIV-1 from infecting primary lymphocytes by using CRISPR / Cas9. Specifically, the present invention uses Ad5F35 recombinant adenovirus expressing CRISPR / Cas9 nuclease system to target edit human primary CD4 + The HIV-1 co-receptor CCR5 on the surface of T lymphocytes destroys the CCR5 expression box or makes CCR5 lose its receptor function, thereby inhibiting HIV-1 virus infection. Background technique [0002] Since it was first reported in 1984 that HIV-1 was the cause of AIDS (AIDS), a large number of top scientists around the world have devoted themselves to overcoming this disease. Ways such as therapy have significantly improved the quality of life of HIV-1 infected patients and greatly reduced the number of new HIV-1 infections; however, there is still a lack of effective vaccines and therapeutics that can cure HIV-1 infecti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/55C12N15/11C12N15/12C12N5/10
Inventor李昌胡勤学
OwnerWUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI