Check patentability & draft patents in minutes with Patsnap Eureka AI!

Promoter and intron in plant seeds for regulating gene expression and application thereof

A technology for plant seeds and gene regulation, applied in the field of agricultural biology, can solve the problems of spatiotemporal expression that needs to be further studied.

Inactive Publication Date: 2015-06-17
SHIHEZI UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The intron of FAD2-1 is located at -9bp upstream of the translation initiation site; in cotton, the 5'UTR intron of FAD2-1 is rich in AT, and has a typical autonomous replicating element (ARS), etc., the intron The role of introns on the temporal and spatial expression of regulated genes still needs further study

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter and intron in plant seeds for regulating gene expression and application thereof
  • Promoter and intron in plant seeds for regulating gene expression and application thereof
  • Promoter and intron in plant seeds for regulating gene expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1, the acquisition of cotton seed dominant expression promoter

[0024] Genomic DNA of the cotton variety "Xinluzao 33" was extracted using the Plant Genomic DNA Extraction Kit from Tiangen Biochemical Co., Ltd. Based on the reported 5′-UTR intron sequence of cotton FAD2-1 gene, long random degenerate primers (AD) were designed using hiTAIL-PCR: 5′-ACGATGGACTCCAGAGCGGCCGC(G / C / A)(G / C / A)N(G / C / A)NNNCCAA-3′. Three hiTAIL-PCR primers are: PA (5′-CGGTGCATGCAGGAACCTCACC-3′), PB (5′-ACGATGGACTCCAGTCCGGCCACCATGGCTTCTTTCTTCGGGCT-3′), and PC (5′- '-GC ATGGCGAAATTCTTCTTCTTCTTTCAC-3'). The AC1 primer is: 5'-ACGATGGACTCCAGAG-3'. The PCR product gel recovery operation steps were carried out according to the instructions of the multifunctional DNA purification and recovery kit of Tiangen Biochemical Company. According to the instructions of the pMD18-T Vector kit from TaKaRa Company, connect the target fragment to pMD18-T Vector, and transform Escherichia coli TOP10, scree...

Embodiment 2

[0025] Example 2, the acquisition of the 5'-UTR intron sequence of the cotton FAD2-1 gene

[0026] Genomic DNA of "Xinluzao 33" was extracted using the Plant Genomic DNA Extraction Kit from Tiangen Biochemical Co., Ltd. Based on the reported 5′-UTR intron sequence of cotton FAD2-1 gene, a pair of specific primers IN-F: CGC was designed GGATCC GGTACATTTCTTTAATTTCCT, IN-R: CGC GGATCC GGACACGCAAGAAGCAAAAC (the underlined part is the increased BamH I restriction site, and the protective base is added before the restriction site): PCR reaction was carried out using the genomic DNA of "Xinluzao 33" as a template. The amplification system is: 10×Ex PCR Buffer 2.5 μL, 2.5 mmol / L dNTP Mixture 2 μL, 10 μmol / L G-P1 and G-P2 1 μL each, cotton genomic DNA 2 μL, Ex Taq (5U / μL) 0.25 μL, add Double distilled water to 25 μL. The amplification conditions were 94°C for 5 min, 35 cycles (94°C for 1 min, 56°C for 1 min, 72°C for 1 min), and 72°C for 10 min. According to the instructions of t...

Embodiment 3

[0027] Embodiment 3, the construction of plant expression vector pBI-FAD2-1 and pBI-FAD2-1-Intron and the transformation of Agrobacterium

[0028] Plasmid vectors were constructed using standard recombinant DNA techniques. The plasmid vector pMD-FAD2-1 was double-digested with Hind III and Bam HI, and a small blunt-ended fragment was recovered. The expression vector pBI121 ( figure 1 ), to recycle large fragments. Combine large fragments with recovered small fragments at T 4 DNALigase was used to connect and transform Escherichia coli TOP10 to screen anti-Kan colonies. Obtain the plant expression vector pBI-FAD2-1 ( figure 2 ). The plasmid vector pMD-Intron was digested with Bam HI to recover small fragments. The expression vector pBI-FAD2-1 was digested with Bam HI, and the large fragment was recovered. Combine large fragments with recovered small fragments at T 4DNA Ligase was used to connect and transform Escherichia coli TOP10 to screen anti-Kan colonies. Use the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a promoter and an intron in plant seeds for regulating gene expression and application thereof, belonging to the technical field of agricultural biotechnology. Exactly, the invention relates to two regulatory elements of temporal and spatial expression of genes in plants, i.e., the promoter coming from a cotton FAD2-1 gene and the intron coming from 5'-UTR of the cotton FAD2-1 gene. The above sequences are used for construction of plant expression vectors, genetic transformation of plants, and regulation and control of the temporal and spatial expression of a target gene in plant seeds. The invention relates to the vectors containing the promoter and the intron, recombinant cells and transgenic plants; meanwhile, the invention also relates to application of the promoter and the intron in regulating and controlling of the expression of the target gene in plants.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology; the invention relates to the regulation of gene spatiotemporal expression in plants. The present invention describes nucleotide sequences from cotton, these nucleotide sequences mainly include two regulatory elements: promoter and intron; use these sequences to construct plant expression vectors, genetically transform plants, and regulate target genes in plant seeds The space-time expression in . Background technique [0002] The promoter is necessary for gene expression, which determines the space, time and intensity of expression of foreign genes in transgenic plants, and is an important limiting factor for people to transform organisms. Plant gene promoters can be roughly divided into three categories according to their mode of action, namely constitutive promoters, inducible promoters and tissue-specific promoters. [0003] The promoters widely used in plant expression vectors are ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00
Inventor 刘峰孙杰汪小东赵伊英
Owner SHIHEZI UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com