Promoter and intron in plant seeds for regulating gene expression and application thereof
A technology for plant seeds and gene regulation, applied in the field of agricultural biology, can solve the problems of spatiotemporal expression that needs to be further studied.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Embodiment 1, the acquisition of cotton seed dominant expression promoter
[0024] Genomic DNA of the cotton variety "Xinluzao 33" was extracted using the Plant Genomic DNA Extraction Kit from Tiangen Biochemical Co., Ltd. Based on the reported 5′-UTR intron sequence of cotton FAD2-1 gene, long random degenerate primers (AD) were designed using hiTAIL-PCR: 5′-ACGATGGACTCCAGAGCGGCCGC(G / C / A)(G / C / A)N(G / C / A)NNNCCAA-3′. Three hiTAIL-PCR primers are: PA (5′-CGGTGCATGCAGGAACCTCACC-3′), PB (5′-ACGATGGACTCCAGTCCGGCCACCATGGCTTCTTTCTTCGGGCT-3′), and PC (5′- '-GC ATGGCGAAATTCTTCTTCTTCTTTCAC-3'). The AC1 primer is: 5'-ACGATGGACTCCAGAG-3'. The PCR product gel recovery operation steps were carried out according to the instructions of the multifunctional DNA purification and recovery kit of Tiangen Biochemical Company. According to the instructions of the pMD18-T Vector kit from TaKaRa Company, connect the target fragment to pMD18-T Vector, and transform Escherichia coli TOP10, scree...
Embodiment 2
[0025] Example 2, the acquisition of the 5'-UTR intron sequence of the cotton FAD2-1 gene
[0026] Genomic DNA of "Xinluzao 33" was extracted using the Plant Genomic DNA Extraction Kit from Tiangen Biochemical Co., Ltd. Based on the reported 5′-UTR intron sequence of cotton FAD2-1 gene, a pair of specific primers IN-F: CGC was designed GGATCC GGTACATTTCTTTAATTTCCT, IN-R: CGC GGATCC GGACACGCAAGAAGCAAAAC (the underlined part is the increased BamH I restriction site, and the protective base is added before the restriction site): PCR reaction was carried out using the genomic DNA of "Xinluzao 33" as a template. The amplification system is: 10×Ex PCR Buffer 2.5 μL, 2.5 mmol / L dNTP Mixture 2 μL, 10 μmol / L G-P1 and G-P2 1 μL each, cotton genomic DNA 2 μL, Ex Taq (5U / μL) 0.25 μL, add Double distilled water to 25 μL. The amplification conditions were 94°C for 5 min, 35 cycles (94°C for 1 min, 56°C for 1 min, 72°C for 1 min), and 72°C for 10 min. According to the instructions of t...
Embodiment 3
[0027] Embodiment 3, the construction of plant expression vector pBI-FAD2-1 and pBI-FAD2-1-Intron and the transformation of Agrobacterium
[0028] Plasmid vectors were constructed using standard recombinant DNA techniques. The plasmid vector pMD-FAD2-1 was double-digested with Hind III and Bam HI, and a small blunt-ended fragment was recovered. The expression vector pBI121 ( figure 1 ), to recycle large fragments. Combine large fragments with recovered small fragments at T 4 DNALigase was used to connect and transform Escherichia coli TOP10 to screen anti-Kan colonies. Obtain the plant expression vector pBI-FAD2-1 ( figure 2 ). The plasmid vector pMD-Intron was digested with Bam HI to recover small fragments. The expression vector pBI-FAD2-1 was digested with Bam HI, and the large fragment was recovered. Combine large fragments with recovered small fragments at T 4DNA Ligase was used to connect and transform Escherichia coli TOP10 to screen anti-Kan colonies. Use the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 