Process for producing L-methionine from O-phospho-L-homoserine and methanethiol employing a mutated cystathionine gamma-synthase

A technology of homoserine and methionine, applied in biochemical equipment and methods, DNA preparation, enzymes, etc.

Active Publication Date: 2015-07-01
AVEATIS ANIMAL NUTRITION SA
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

One limitation of making methionine is the energy cost of reducing sulfur

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Process for producing L-methionine from O-phospho-L-homoserine and methanethiol employing a mutated cystathionine gamma-synthase
  • Process for producing L-methionine from O-phospho-L-homoserine and methanethiol employing a mutated cystathionine gamma-synthase
  • Process for producing L-methionine from O-phospho-L-homoserine and methanethiol employing a mutated cystathionine gamma-synthase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0251] Example 1: Preparation of truncated forms of CGS1 used as starting material for the preparation of mutants

[0252]The CGS1-4 genes are synthetic genes. Synthesis was performed by Eurofins MWG Operon, (Ebersgerg) using the GENEius algorithm to optimize codon usage for improved expression in Saccharomyces cerevisiae. The S. cerevisiae codon usage table used was derived from the Kazusa Codon Usage Detabase (http: / / www.kazusa.or.jp / codon). Truncated forms of CGS1-5 and CGS1-1 have been obtained by using CGS1-4 as a substrate, using the forward oligonucleotide, GTACCGCTCGAG for CGS1-5 ATG GTTGCTGGTAAGTGGTCTAACAATC and GTACCGCTCGAG for CGS1-1 ATG TCTGTTCAATTGACCGATTCTAAG, prepared by PCR. For the CGS1-5 and CGS1-1 formats, use the equivalent reverse oligo AGTACGGGATCC TCA AATGGCTTCCA.

[0253] image 3 The truncated modified form of CGS1 is schematically represented in .

Embodiment 2

[0254] Example 2: Preparation of mutants of truncated forms of CGS1

[0255] A truncated version of the CGS1 gene was cloned into the pAL06 plasmid, a yeast replicating vector derived from the pRS316 vector (Sikorski RS & Hieter P., Genetics. 1989, 122: 19-27). The pAL06 plasmid allows expression of the cloned gene under the control of the strong yeast promoter TEF1. CGSA libraries were generated by hypermutation PCR at deoxynucleotide metaphosphate (dNTP) concentrations using the protocol described by Vartanian JP et al. (Nucleic Acids Res. 1996 24:2627-2631). [dTTP]>[dCTP] and [dGTP]>[dATP] biases are both used in mutation PCR. in 0.5mM MnCl 2 Use [dTTP] / [dCTP]=[dGTP] / [dATP]=1000 μM / 200 μM or [dTTP] / [dCTP]=[dGTP] / [dATP]=1000 μM / 150 μM.

Embodiment 3

[0256] Example 3: Screening of mutants that can prepare L-homoserine from O-phospho-L-homoserine and methylmercaptan

[0257] In yeast strains YA247-5A (MAT-α, ade2, his3, leu2, met2::loxP, met6::HIS3, trp1, ura3) or YA246-4A (MAT-a, ade2, his3, leu2, met2::loxP , met6::HIS3, thr4::loxP, trp1, ura3) in minimal medium supplemented with methionine but lacking uracil to transform the CGS1 library to select for plasmid markers. After 48 hours of growth, cells were harvested, washed and resuspended in minimal liquid medium containing methanethiol as the sulfur source. After 7 days, the culture was harvested and diluted with the same liquid medium to OD 600nm About 0.2. Three consecutive dilution cycles were performed.

[0258] The plasmids present in the resulting growing yeast cells were then extracted, expanded into E. coli and the resulting DNA used to retransform strain YA247-5A (MAT-α, ade2, his3, leu2, met2::loxP, met6::HIS3 , trp1, ura3) or YA246-4A (MAT-a, ade2, his3, l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided is a method for producing L-methionine in which O-phospho-L-homoserine and methanethiol are enzymatically converted into L-methionine and H3P04. Such a conversion is achieved by an enzyme called O-phospho-L-homoserine (OHPS) dependent methionine synthase. Also described are O-phospho-L-homoserine (OHPS) dependent methionine synthases, i.e. proteins which are able to enzymatically convert O-phospho-L-homoserine and methanethiol into L-methionine and H3PO4 as well as microorganisms which have been genetically modified so as to be able to produce L-methionine from O-phospho-L-homoserine and methanethiol. Furthermore described are methods to screen for enzymes that catalyse the conversion of O-phospho-L-homoserine and methanethiol into L-methionine and H3PO4.

Description

technical field [0001] The present invention relates to a process for the preparation of L-methionine, wherein O-phospho-L-homoserine and methylmercaptan are enzymatically converted into L-methionine and H 3 PO 4 . The conversion is achieved by an enzyme called O-phospho-L-homoserine (OHPS)-dependent methionine synthase. The present invention also provides O-phospho-L-homoserine-dependent methionine synthase, that is, capable of enzymatically converting O-phospho-L-homoserine and methylmercaptan into L-methionine and H 3 PO 4 of protein. The present invention also relates to microorganisms which have been genetically modified to produce L-methionine from O-phospho-L-homoserine and methylmercaptan. [0002] The enzymes and methods can also be advantageously used for the synthesis of derivatives of methionine such as S-adenosylmethionine, glutathione, cysteine, S-adenosylhomocysteine ​​and methionine. Thioadenosine. The present invention also provides screening for cataly...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P13/12C12P11/00C12P19/40C12P21/02C12N9/10C12N15/10
CPCC12P21/02C12P11/00C12P19/40C12P13/12C12N9/1085C12Y205/01048C12P13/02
Inventor缪里·梅尔卡姆多米尼克·路易斯卡琳·加拉尔东多米尼克·托马斯菲力浦·马利尔
OwnerAVEATIS ANIMAL NUTRITION SA