Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for producing antiangiogenesis agent RT-X in colibacillus and application of antiangiogenesis agent RT-X

A technology of RT-X and Escherichia coli, applied in the field of fusion protein RT-X technology and separation and purification, can solve problems such as RGD without literature reports

Active Publication Date: 2015-07-22
南通大学技术转移中心有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The αvβ3 antibody currently being researched and developed includes Vitaxin (LM609), which is clinically used for anti-angiogenic therapy (Gutheil, JC., et al.Targeted antiangiogenic therapy for cancer using Vitaxin: a humanized monoclonal antibody to the integrin alphavbeta3.Clin Cancer Res .2000.6, 3056–3061), but the reported effect is not satisfactory (Posey, JA., et al. A pilot trial of vitaxin, a humanized anti-vitronectin receptor (anti alphavbeta3) antibody in patients with metastatic cancer. Cancer Biother Radiopharmac.2001.16,125–132)
Most of the more than 20 integrins recognize extracellular matrix ligands of the RGD (arginine-glycine-aspartic acid) sequence (Dennis MS., et al. Platelet glycoprotein IIb-IIIa protein antagonists from snake venoms:evidence for a family of platelet-aggregation inhibitors. Proc Natl Acad Sci.1990.87, 2471-2475), RGD has the function of antagonizing integrins, reducing the expression of cell surface adhesion molecules and inducing cell apoptosis, but its half-life is short, and it will be destroyed in vivo. Rapid clearance, but the RGD sequence can be used as a carrier, coupled with other active molecules to achieve the effect of targeting tumor vascular endothelium, and has broad application prospects in tumor therapy
[0007] At present, there is no literature report on modifying the sequence of Maspin protein to improve its targeting and anti-tumor activity in vivo, and there is no literature report on the synergistic inhibition of RGD and Maspin protein Angiogenesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing antiangiogenesis agent RT-X in colibacillus and application of antiangiogenesis agent RT-X
  • Method for producing antiangiogenesis agent RT-X in colibacillus and application of antiangiogenesis agent RT-X
  • Method for producing antiangiogenesis agent RT-X in colibacillus and application of antiangiogenesis agent RT-X

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Example 1 Cloning, expression, separation and purification of the vascular inhibitor RT-X gene

[0084] The Maspin gene refers to the cDNA sequence of Maspin (Genbank sequence number: AY893387.1), and the gene sequence is shown in SEQ ID NO:5;

[0085] ATGGATGCCCTGCAACTAGCAAATTCGGCTTTTGCCGTTGATCTGTTCAAACAACTATGTGAAAAGGAGCCACTGGGCAATGTCCTCTTCTCTCCAATCTGTCTCTCCACCTCTCTGTCACTTGCTCAAGTGGGTGCTAAAGGTGACACTGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGATTTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCAAGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGAGACCCTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAGGTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTGACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCAAGTGGATGAAGAAATTTCCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGACAGACACCAAACCAGTGCAGATGATGAACATGGAGGCCACGTTCTGTATGGGAAACATTGACAGTATCAATTGTAAGATCATAGAGCTTCCTTTTCAAAATAAGCATCTCAGCATGTTCATCCTACTACCCAAGGATGTGGAGGATGAGTCCACAGGCTTGGAGA...

Embodiment 2

[0105] Example 2 Analysis of biological activity of fusion protein RT-X

[0106] 1. Endothelial Cell Migration Assay

[0107] Matrigel preparation: place the matrigel frozen at -80°C at 4°C overnight to become liquid; take 150 μL of Matrigel, coat the upper chamber of the Transwell (operated on ice), put it in a 37°C incubator, and incubate for 1 hour; digest HUVEC cells were washed 3 times in serum-free medium, counted, and made into 2×10 6 Cell suspension; wash Matrigel-coated Transwell once with serum-free medium; add 100 μL cell suspension to each well; add 600 μL conditioned medium containing 20% ​​FBS to the lower chamber of Transwell; incubate at 37°C for 48 hours; take out Wash 2 times with PBS, wipe off the upper surface cells with cotton balls, fix with neutral formaldehyde for 10 minutes; add crystal violet (0.1%) to stain for 10 minutes, wash 2 times with PBS at room temperature, observe and take pictures under a microscope. Count the number of positively stained...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Average volumeaaaaaaaaaa
Login to View More

Abstract

The invention relates to the technical field of bio-engineering and pharmaceuticals, in particular to a process for producing targeting anti-tumor antiangiogenesis fusion protein RT-X in colibacillus as well as a separation and purification method for the fusion protein RT-X. The fusion protein RT-X is soluble, has biological activity, and comprises RGD and Maspin protein. Through the adoption of the expressed and purified antiangiogenesis agent RT-X with the biological activity, endotheliocyte can be inhibited from migration according to specificity and dose dependence, and an effect for inhibiting angiogenesis is realized in a chicken embryo chorioallantoic membrane animal experiment. The process and the separation and purification method are applicable to research in bio-engineering pharmacy and gene engineering, biochemistry, molecular biology and other fields.

Description

Technical field: [0001] The invention relates to the technical fields of bioengineering and medicine, in particular to a process and a separation and purification method for producing a soluble and biologically active fusion protein RT-X with targeting anti-tumor blood vessel inhibition in Escherichia coli. Background technique: [0002] In recent years, with the in-depth study of tumor anatomy and molecular biology, people have gradually realized that angiogenesis plays a key role in the growth and metastasis of solid tumors. Since Algureza proposed the concept of tumor-induced angiogenesis in 1947, until 1971, folkman clearly proposed the theory that tumor growth and metastasis depend on new angiogenesis. New blood vessels not only provide the necessary nutrients and oxygen for tumor growth, but also help eliminate metabolites , or the way of its distant metastasis (Folkman, J. What is the evidence that tumors are angiogenesis dependent J. Natl. Cancer Inst. 1990: 82: 4-6)...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N1/21C12N15/62C07K19/00C07K1/36C07K1/34C07K1/22A61K38/57A61K47/48A61P35/00
Inventor 殷润婷张志强张伟
Owner 南通大学技术转移中心有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More