siRNA for inhibiting expression of FABP4 gene and application of sirna

A FABP4, gene expression technology, applied in the direction of DNA / RNA fragments, applications, gene therapy, etc.

Inactive Publication Date: 2015-08-12
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the siRNA that can effectively inhibit the expression of FABP4 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • siRNA for inhibiting expression of FABP4 gene and application of sirna
  • siRNA for inhibiting expression of FABP4 gene and application of sirna
  • siRNA for inhibiting expression of FABP4 gene and application of sirna

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Synthesis of siRNA that inhibits FABP4 gene expression

[0040]Based on the known sequence of FABP4 in the GeneBank gene bank, the present invention designs three pairs of siRNA sequences according to the principle of siRNA design. Through cytological intervention, fluorescence localization and RT-PCR gene detection, it is verified that the following sequences can significantly inhibit FABP4 gene expression. The three pairs of siRNA sequences designed by the present invention are respectively (commissioned by genepharma biological company to synthesize):

[0041] siRNA-309:

[0042] Sense strand: 5'-GAGCAUCAUAACCCUAGAUtt-3'

[0043] Antisense strand: 5'-AUCUAGGGUUAUGAUGCUCtt-3'

[0044] siRNA-368:

[0045] Sense strand: 5'-CGACCACAAUAAAGAGAAAtt-3'

[0046] Antisense strand: 5'-UUUCUCUUUAUUGUGGUCGtt-3'

[0047] siRNA-432:

[0048] Sense strand: 5'-CGACCACAAUAAAGAGAAAtt-3'

[0049] Antisense strand: 5'-UUUCUCUUUAUUGUGGUCGtt-3'

[0050] The negative cont...

Embodiment 2

[0055] Example 2 Cell culture and transfection inhibit the expression test of FABP4 gene

[0056] 1. Cell culture

[0057] (1) Recovery of 3T3-L1 preadipocyte line

[0058] Take out the cell line from liquid nitrogen, put it in a 37°C water bath immediately, and revive it by rapid shaking for about 1.5-2min. Add the recovered cells into a 50ml centrifuge tube containing 5ml of culture medium, and centrifuge at room temperature for 4min at 900rpm. Pour off the supernatant, add 5ml of culture medium, and observe the cell morphology and number under a microscope. placed in 5% CO 2 Cultured in a constant temperature incubator at 37°C, and the medium was changed after 24 hours. The 3T3-L1 preadipocyte cell line used in the present invention was kindly donated by the Laboratory of Endocrinology Department of Shanghai Ruijin Hospital.

[0059] (2) Culture and passage of 3T3-L1 preadipocyte line

[0060] Observe under a microscope that the cells have adhered to the wall, appear ...

Embodiment 3

[0067] Embodiment 3 RT-PCR experiment detects FABP4 gene expression

[0068] After siRNA transfection into cells, in 5% CO 2 Incubate for 48 hours at 37°C in an incubator. Total cellular RNA was extracted by Trizol method and reverse transcribed into cDNA.

[0069] Entrust Shanghai Bioengineering Company to synthesize FABP4 primers, primer sequence:

[0070] FABP4-F: CATGGCCAAGCCCAACAT

[0071] FABP4-R: CGCCCAGTTTGAAGGAAATC

[0072] The RT-PCR system is as follows:

[0073] Element

volume

2×SYBR Green Mix

10ul

FABP4 Primer Mix

1ul

cDNA

2ul

wxya 2 o

7ul

total capacity

20ul

[0074] Aliquot to AXYGEN PCR8-connected tubes, and centrifuge briefly in a microcentrifuge to mix. The above samples were put into the Eppendorf Realplex fluorescent quantitative PCR instrument, and the SYBR Green method fluorescent quantitative PCR was used to analyze the expression of each gene. The PCR program was set as...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an siRNA for inhibiting expression of an FABP4 gene. A sequence of the siRNA is shown as follows: sense strand: 5'-CGACCACAAUAAAGAGAAA-3' antisense strand: 5'-UUUCUCUUUAUUGUGGUCG-3'. According to the siRNA disclosed by the invention, three pairs of siRNA sequences are designed, aiming at the FABP4 gene, and an siRNA which is capable of effectively down regulating expression of a target gene is screened by virtue of a cell transfection test; according to the screened siRNA-368 sequence, a corresponding lentivirus expression carrier is constructed; and verified by a test of transfecting an obese mouse with high fat and inhibiting expression of mouse visceral fat tissue FABP4 gene, the screened siRNA is capable of effectively inhibiting expression of the mouse FABP4 gene and lowering weight, glycosylated hemoglobin, total cholesterol and level of low-density lipoprotein cholesterol of the obese mouse with high fat.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to an siRNA inhibiting the expression of FABP4 gene and its application in the preparation of drugs for weight loss, fat-lowering or blood sugar-lowering. Background technique [0002] RNA interference (RNA interference, RNAi) refers to the phenomenon of efficient and specific degradation of homologous mRNA induced by double-stranded RNA, which is highly conserved in the evolutionary process. A protective mechanism of sexuality. When exogenous genes such as viral genes, artificially transferred genes, and transposons are randomly integrated into the host cell genome and transcribed by the host cell, some dsRNA is often produced. Host cells respond rapidly to these dsRNAs, and Dicer of the RNaseIII ribozyme family in the cytoplasm cuts dsRNAs into multiple small fragments of RNA (siRNA) with specific length and structure. siRNA is unzipped into sense and antisense strands under...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/11C12N15/867C12N7/01A61K48/00A61P3/04A61P3/06
Inventor张征邹大进缪朝玉王培杨茜
OwnerSECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY