Primer, kit as well as PCR method for detecting of D816V mutation site of C-KIT gene
A D816V, mutation site technology, applied in the field of molecular biology gene detection, can solve the problems of inability to simultaneously detect large-scale clinical specimens, complicated interpretation of kit results, and low clinical popularity, so as to avoid site mismatch and detection. The effect of fast speed and good sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0121] Example 1: Preparation of wild-type and mutant-type positive plasmids for the C-KIT gene D816V mutation site
[0122] C-KIT encodes KIT receptors and is involved in regulating gene expression, controlling cell growth and proliferation. Mutations in C-KIT gene can lead to malignant tumors such as acute myeloid leukemia, gastrointestinal stromal tumor and testicular cancer. Clinical studies have shown that the mutation of the C-KIT gene in gastrointestinal stromal tumors is closely related to the efficacy of Imatinib molecular targeted therapy. Patients with C-KIT exon 11 mutation had the best curative effect, followed by patients with exon 9 mutation, and GIST patients without gene mutation had the worst curative effect. The American Cancer Comprehensive Network (NCCN) "Guidelines for the Clinical Treatment of Soft Tissue Sarcoma" proposes that before receiving targeted drug therapy, GIST patients should be tested for C-KIT gene mutations, and whether to use targeted dru...
Embodiment 2
[0140] Example 2: Design and specificity screening of allele-specific primers (ASP)
[0141] For the C-KIT gene D816V mutation site, wild-type and a series of mutation-specific primers were designed as follows:
[0142] C-KIT-D816V-WT-F: gatttgtgattttggtctagccagtga (SEQ No. 8)
[0143] C-KIT-D816V-mut-F: gatttgtgattttggtctagccagtgt (SEQ No. 9)
[0144] C-KIT-D816V-mut-F1: atttgtgattttggtctagccagtgt (SEQ No. 10)
[0145] C-KIT-D816V-mut-F2: tttgtgattttggtctagccagtgt (SEQ No. 11)
[0146] C-KIT-D816V-mut-F3: gatttgtgattttggtctagccagact (SEQ No. 12)
[0147] C-KIT-D816V-mut-F4: atttgtgattttggtctagccagact (SEQ No. 13)
[0148] C-KIT-D816V-mut-F5: tttgtgattttggtctagccagact (SEQ No. 14)
[0149] Simultaneously design and synthesize Taqman-specific probe C-KIT-D816V-Probe:
[0150] SEQ No. 15: FAM-aaaggaaacgtgagtacccattctctgctt-BHQ1.
[0151] Relevant primers and probes were synthesized at Sangon Bioengineering (Shanghai) Co., Ltd.
[0152] Then use the above 7 primers to pai...
Embodiment 3
[0154] Embodiment 3: ASP sensitivity screening
[0155] Then use the mutant primers after screening to pair with the common downstream primer SEQ No.16 of the C-KIT gene D816V mutation site, and use the mutant recombinant plasmid according to 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 0 for serial dilution, plus Taqman-specific probes, sensitivity verification was performed on a fluorescent quantitative PCR instrument. The mutation-specific primer can detect 100 copies of the mutant, so this primer is the best primer for detecting the D816V mutation site of the C-KIT gene screened according to our method, as shown in Table 3.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com