[0020] Example 1 (Preparation Example)
[0021] Use CRISRP/Cas9 system to produce leukemia CAR-T cells:
[0022] 1) T cell separation and culture
[0023] a. Separate fresh peripheral blood mononuclear cells (PBMC, peripheral blood mononuclear cell) by density gradient centrifugation;
[0024] b. Use paramagnetic beads coupled with anti-CD3 and anti-CD28 antibodies (Dynabeads ClinExVivo CD3/CD28, Invitrogen, Camarillo, CA, USA) to enrich CD3+ cells, the ratio of magnetic beads to cells is 3:1; the cells are diluted to TNC (Total nucleated cell) concentration is 20-30x106/mL, incubated with magnetic beads in a petri dish for 2 hours at room temperature;
[0025] c. Use Magnetic particles concentrator (MPC) (Invitrogen) to enrich CD3+ cells; cells containing CD3+ are resuspended in culture medium (OpTmizer TM CTS TM In T-Cell Expansion SFM, Life Technologies), the final concentration is 1x 106 cells/mL. Incubate for 2 days in a 37°C, 5% CO2 incubator.
[0026] 2) Construction of CRISPR/Cas9 plasmid
[0027] Synthetic oligonucleotides gRNA-A1, gRNA-A2, gRNA-B1, gRNA-B2, the sequence is as follows:
[0028] gRNA-A1: CACCGTGGGGGTTAGACCCAATATCAGG
[0029] gRNA-A2: CCCTGATATTGGGTCTAACCCCCA
[0030] gRNA-B1: CACCGTGTTAGGCAGATTCCTTATCTGG
[0031] gRNA-B2: CCCAGATAAGGAATCTGCCTAACA
[0032] Annealing gRNA-A1 and gRNA-A2 to form double-stranded gRNA-A; annealing gRNA-B1 and gRNA-B2 to form double-stranded gRNA-B. Connect gRNA-A and gRNA-B to the vector pX334 (#42333, Addgene) digested with BbsI, respectively, to form CRISPR/Cas9 plasmids pX334-gRNA-A and pX334-gRNA-B. Donor DNA consists of HA-L (left homology arm), SA (splice acceptor site), FMC63-28Z (leukemia CAR molecule), bGH-PA-terminator (transcription terminator) and HA-R (right side) Source arm) composition, sequence see sequence table 2.
[0033] 3) Electroporation of T cells
[0034] Take 250uL of cells with a concentration of 1x 107cells/mL and place them in a 0.2cm Bio-rad electroporation cuvette; add the plasmids pX334-gRNA-A, pX334-gRNA-B and donor DNA to the cells in the electroporation cuvette at the same time and mix carefully; set The voltage is 140V, and the electroporation cup is placed in the electroporation tank; after the electroporation is completed, the electroporation cup is taken out, and the transfected cells are carefully transferred to the culture plate, and cultured in a 37°C, 5% CO2 incubator for 48 hours.
[0035] 4) Screening and amplification of positive clones
[0036] a. Days 2-5: Screening with puromycin (Sigma, P8833). For 4 consecutive days, use the culture medium containing freshly prepared puromycin (0.5ug/ml) for medium exchange culture;
[0037] b. Day 6: Change to normal culture medium without puromycin and continue culturing until day 7-10, when the clones grow to about 2mm in diameter, clones can be picked; usually 20 clones are picked and placed in a 24-well culture plate Culture in medium, change the medium every day until the cells grow into a confluent state, then proceed to the next analysis or freeze the cells.
[0038] 5) Genotype identification
[0039] Extract cell genomic DNA (DNeasy Blood&Tissue Kit, Qiagen) as a template, use primers AAVS1F and AAVS1R for PCR amplification, and run DNA electrophoresis to compare band sizes. The PCR band with CAR molecule inserted is 2343bp, and the PCR band without CAR molecule is 360bp. The genomic DNA with the correct PCR band was sequenced to further confirm the correctness of the CAR molecule. The PCR primers are as follows:
[0040] AAVS1F:TGTCCCCGAGCTGGGACCAC
[0041] AAVS1R:TGGGAGAGGGTAGCGCAGGG
[0042] 6) Flow cytometric analysis to detect the expression of CAR molecules
[0043] a. Centrifuge the cells, and evaluate the expression of CAR molecules on the surface of T cells by the Protein L experiment using flow cytometry. Biotinylated Protein L (Thermo Scientific, Rockford, IL, USA) was resuspended in sterile water at a concentration of 50ng/uL, stored at 4°C; 5ug was used to label 1x 106 cells. The cells were incubated with Protein L for 30 minutes at 4°C in the dark. The final concentration of Protein L is determined by titer experiment. Wash the tube twice with cold fluorescence-activated cell sorting buffer to remove excess reagents. Take 30uL of phycoerythrin-labeled streptavidin (BD Biosciences, San Jose, CA, USA) diluted 1:120 in PBS into the tube and wash it after 20 minutes.
[0044] b. 7-Aminoactinomycin D (Immunotech, Marseille, France) was used to determine the activity; the final product was tested for CD3, CD8 (Invitrogen), CD4, CD19 (BD Biosicences). The negative control is tested in the same way. BD FacsCanto II (BD Biosicences) was used to obtain stained cells, and FlowJo (Treestar Inc, Ashland, OR, USA) was used to analyze the results.
[0045] CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats) is a newly emerged technology that uses RNA-guided Cas9 nuclease to edit targeted genes in the last two years. It was selected as one of the top ten advances in Science in 2013 (Couzin- Frankel J et al, Science 2013, 342(6165):1432-1433). In this system, the sgRNA (single guide RNA) containing the complementary sequence to the target site guides the Cas9 protein to cut the double-stranded DNA at the sequence target site to play a role of targeted cutting. At this time, if we provide the donor DNA, homologous recombination (HR) occurs between the induction site and the donor DNA, and the DNA fragments on the donor can be integrated into the genome.
[0046] The CRISPR/Cas9 system is easy to operate and has high genome editing efficiency, and can perform highly efficient targeted editing of the genome of any species. In order to avoid potential off-target effects, we use a mutated Cas9 enzyme Nickase Cas9 to overcome this limitation. It only cuts one strand of DNA. This single-strand gap will promote homologous recombination, but will not produce off-target mutations (Ran FA et al. al,Cell 2013,154(6):1380-9).
[0047] The AAVS1 (also known as PPP1R2C site) on human chromosome 19 is a proven "safe harbor" site that can ensure the expected function of the transferred DNA fragment. This site is an open chromosome structure, which can ensure that the transferred gene can be transcribed normally. Another important point is that inserting foreign gene fragments at this site has no known side effects on cells. The CRISPR/Cas9 system targeting the AAVS1 site can specifically cut the AAVS1 site on human chromosome 19, generate broken DNA, trigger the natural repair mechanism of DNA, and induce homologous recombination between the site and the AAVS1 donor DNA (HR), integrate the DNA fragments on the donor into the "safe harbor" site on the genome (Mali P et al, Science 2013, 339(6121):823-6).
[0048] Therefore, using this technology, we can accurately integrate CAR molecules into specific "safe harbor" sites in the human T cell genome, without affecting the function of any normal human genes, and avoiding the hidden dangers of using viral vectors and foreign genes. A series of clinical risk issues such as genetic toxicity and immunogenicity of transgenic genome insertion.
