Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of microRNA-326 inhibitor to the preparation of medicament for treating cataract

1. Microrna-326, a technology for preparing drugs, applied in the field of molecular biology, can solve problems such as weakening stability, abnormal lens structure, and change of lens transparency, and achieve a significant inhibitory effect

Inactive Publication Date: 2015-09-16
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] BetaB2 crystallin protein (CRYBB2) is closely related to the occurrence of cataracts. Studies have shown that its expression decreases in the lens of cataract patients (Huang CH, Wang YT, Tsai CF, Chen YJ, Lee JS, Chiou SH. Phosphoproteomics characterization of novel phosphorylated sites of lens proteins from normal and cataractous human eye lenses. Molecular Vision 2011; 17:186-198.), CRYBB2 gene mutations often occur on exon 6, resulting in abnormal amino acid folding, resulting in abnormal lens structure, weakening the water-soluble Stability in the state, causing changes in the transparency of the lens, eventually leading to the occurrence of congenital cataracts (Chen W, Chen X, Hu Z, Lin H, Zhou F, Luo L, Zhang X, Zhong X, Yang Y, Wu C ,Lin Z,Ye S,Liu Y.A Missense Mutation in CRYBB2Leads to Progressive Congenital Membranous Cataract by Impacting the Solubility and Function of bB2-Crystallin.PLoS One.2013;8(11):e81290.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of microRNA-326 inhibitor to the preparation of medicament for treating cataract
  • Application of microRNA-326 inhibitor to the preparation of medicament for treating cataract
  • Application of microRNA-326 inhibitor to the preparation of medicament for treating cataract

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] 1 Materials and methods

[0039] 1.1 Materials

[0040] 1.1.1 Research object

[0041] Human lens epithelial cells HLEC-B3 cell line was purchased from Wuhan Primary Primary Biomedical Technology Co., Ltd.

[0042] Mouse C57BL / C, gray, was purchased from the Experimental Animal Center of Second Military Medical University.

[0043] 1.1.2 Carriers used

[0044] The dual luciferase reporter gene vector pmirGLO was purchased from Promega Company, the product number is Cat.#E1330, and the vector map is as follows: figure 1 shown; the expression vector pLKO.1 was purchased from Addgene, and the vector map is as follows figure 2 shown; the green fluorescent protein expression vector pEGFP-N1 was purchased from Addgene, and the vector map is as follows image 3 Indicated, used as a control plasmid in this study.

[0045] 1.1.3PCR primer sequence

[0046] Primer Sequence(5′→3′) SEQ ID NO. R-H-FGF1-F GCTCACACATTTGCCCCAAG 1 R-H-FGF1-R GGAGCCAAGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to application of a microRNA-326 inhibitor to the preparation of medicaments for treating cataract. By experiments, the present invention proves that microRNA-326 can inhibit the expression of FGF1 to further achieve down-regulation of expression of betaB2 crystal protein; and the content change if betaB2 crystal protein is a key factor in cataract, and the down-regulation of expression of betaB2 crystal protein causes cataract. The invention suggests that inhibition of microRNA-326 can be used for the treatment of cataract, and microRNA-326 can be used as marker for cataract diagnosis.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to the application of an inhibitor of microRNA-326 in the preparation of a medicine for treating cataract. Background technique [0002] All kinds of reasons, such as aging, genetics, local nutritional disorders, immune and metabolic abnormalities, trauma, poisoning, radiation, etc., can cause lens metabolic disorders, resulting in lens protein denaturation and opacity, which is called cataract. Obstruction cannot be projected on the retina, resulting in blurred vision. It is more common in people over 40 years old, and the incidence rate increases with age. [0003] microRNAs (miRNAs) are a class of endogenous non-coding RNAs with regulatory functions found in eukaryotes. Mature miRNAs are produced from longer primary transcripts through a series of nuclease cleavage processes, and then assembled into RNA-induced silencing complex (RNA-induced silencing complex, RISC), ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7088A61P27/12C12N15/113C12N15/861C12Q1/68
Inventor 高谦任含笑陶海波李闻捷牛紫光贾音沈炜
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More