Primer pair and kit for detecting duck adenovirus II type

An adenovirus and primer pair technology, applied in the field of poultry disease detection, can solve the problems of many reagent requirements, strong non-specificity, laborious sensitivity, etc., and achieve the effects of avoiding economic losses, short detection time, and strong specificity

Inactive Publication Date: 2015-11-11
WENS FOOD GRP CO LTD
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods are time-consuming, labor-intensive, and have poor sensitivity. Generally, it will take several days or even longer, require mor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer pair and kit for detecting duck adenovirus II type
  • Primer pair and kit for detecting duck adenovirus II type
  • Primer pair and kit for detecting duck adenovirus II type

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] 1. Experimental Materials:

[0019] (1) Disease materials: 6 parts of disease materials collected from duck farms in Guangdong, Zhejiang and other places, including liver, pancreas, pericardial fluid, bursa tissue, throat test paper, and feces test paper, respectively numbered ZL, LY, SY, ZJ, RM, HZ. Among them, ZL was identified as duck adenovirus type 2 infection, which was used as a positive control.

[0020] (2) Reagents:

[0021] taco nucleic acid automatic extractor and supporting reagents, PremixTaq enzyme (TaKaRa company), ddH 2 O (ultrapure water), GoldView nucleic acid dye, 10×TAE; MarkerDL2000 (TaKaRa company).

[0022] (3) Design and synthesis of primers:

[0023] Upstream primer P1: TACGCAGGGCAAGGTATCAAG (SEQ ID NO: 1);

[0024] Downstream primer P2: CGCTCATTCGCTTCTGTCTGT (SEQ ID NO: 2).

[0025] 2. Experimental program:

[0026] (1) Preparation of DNA template: The diseased material collected from the duck farm was ground, centrifuged, and the sup...

Embodiment 2

[0047] Embodiment 2: specificity experiment

[0048] Nucleic acid extraction of various virus culture fluids such as parvovirus vaccine, Newcastle disease virus fluid, Tembusu virus fluid, type C lung virus fluid, reovirus fluid, new reovirus fluid, avian adenovirus type 1 virus fluid, etc. Among them, Newcastle disease virus liquid, Tembusu virus liquid, C-type lung virus liquid, reovirus liquid, and new reovirus liquid are RNA viruses, and AMV reverse transcriptase XL from TaKaRa Company is used for reverse transcriptase according to the following 20 μL system. Transcript:

[0049] Template RNA 4μL;

[0050] 5×Reverse Transcriptase Ruffer 4μL;

[0051] DNTP Mixture (10mMeach) 2μL;

[0052] RNase Inhibitor 0.5 μL;

[0053]RadomPrimer (50 μM) 1 μL;

[0054] AMVRever Transcriptase 2μL;

[0055] DEPCH 2 O6.5 μL.

[0056] 10min at 25°C; 60min at 42°C; 15min at 72°C; store at 4°C. Using ZL in Example 1 as a positive control, the above-mentioned extracted DNA and the cDNA ...

Embodiment 3

[0057] Embodiment 3: Sensitivity experiment

[0058] Dilute the DNA extracted from the sample ZL in the above-mentioned embodiment 1, and dilute it to: 1×10 -1 , 1×10 -2 , 1×10 -3 , 1×10 -4 , 1×10 -5 , 1×10 -6 There are six gradients in total, the original DNA concentration is 12.79ng / μL, and the DNA amounts of 2μL template are: 2.558ng, 0.2558ng, 25.58pg, 2.558pg, 0.2558pg, 0.02558pg. Adopt PCR step program in embodiment 1, do PCR with primer of the present invention, from image 3 It can be seen that the extracted DNA is diluted to 100 times, and when the DNA content is 0.2558ng, the PCR detection is a strong positive, and when it is diluted to 1000 times, a weak positive can be detected when the DNA content is 25.58pg, indicating that the primers and PCR detection of the present invention The method can detect at least 0.2558ng of template DNA, and has good sensitivity.

[0059]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a primer pair and a kit for identifying duck adenovirus II type, wherein the nucleotide sequence of the primer pair is represented as the SEQ ID No.1-2. The primer pair is strong in specificity, can accurately and high-effectively identify whether a to-be-test sample contains the duck adenovirus II type or not, while other poultry viruses, comprising poultry adenovirus, parvovirus, Tembusu virus and Newcastle disease virus, cannot be amplified to form DNA fragments. The primer pair is high in sensitivity, can at least detect 0.2258 ng of sample DNA. The primer and the PCR detection kit are short in detection time, wherein the whole PCR process only lasts for about 2 h. The primer pair and the kit are simple and economical, are free of expensive experimental instrument and reagents, can be used for detecting whether ill ducks are infected with the virus or not timely, so that greater economic loss can be avoided by means of corresponding measures.

Description

technical field [0001] The invention relates to the technical field of poultry disease detection, in particular to a primer pair and a kit for detecting duck adenovirus type 2. Background technique [0002] Adenoviruses are common infectious agents of poultry and wild birds worldwide. The International Committee on Taxonomy of Viruses (ICTV) has stipulated the basic characteristics of adenovirus classification. The report divides adenovirus into two genera of mammalian adenovirus and avian adenovirus. Avian adenoviruses are serologically different from mammalian adenoviruses and have differences in their genetic structure. Avian adenoviruses are divided into subgroups I, II, and III. At present, experts and scholars at home and abroad are focusing on subgroups I and III. Duck adenovirus type 2 (Duckadenovirus2, DADV2) belongs to the tentative species of subgroup I. It was first isolated from Muscovy duck by J.F.Bouquet et al. in Hungary in 1977. It has no relationship with...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12R1/93
Inventor 林丽苗操胜招丽婵覃健萍周庆丰王占新孙石开
Owner WENS FOOD GRP CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap