Primer pair and kit for detecting duck adenovirus II type
An adenovirus and primer pair technology, applied in the field of poultry disease detection, can solve the problems of many reagent requirements, strong non-specificity, laborious sensitivity, etc., and achieve the effects of avoiding economic losses, short detection time, and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] 1. Experimental Materials:
[0019] (1) Disease materials: 6 parts of disease materials collected from duck farms in Guangdong, Zhejiang and other places, including liver, pancreas, pericardial fluid, bursa tissue, throat test paper, and feces test paper, respectively numbered ZL, LY, SY, ZJ, RM, HZ. Among them, ZL was identified as duck adenovirus type 2 infection, which was used as a positive control.
[0020] (2) Reagents:
[0021] taco nucleic acid automatic extractor and supporting reagents, PremixTaq enzyme (TaKaRa company), ddH 2 O (ultrapure water), GoldView nucleic acid dye, 10×TAE; MarkerDL2000 (TaKaRa company).
[0022] (3) Design and synthesis of primers:
[0023] Upstream primer P1: TACGCAGGGCAAGGTATCAAG (SEQ ID NO: 1);
[0024] Downstream primer P2: CGCTCATTCGCTTCTGTCTGT (SEQ ID NO: 2).
[0025] 2. Experimental program:
[0026] (1) Preparation of DNA template: The diseased material collected from the duck farm was ground, centrifuged, and the sup...
Embodiment 2
[0047] Embodiment 2: specificity experiment
[0048] Nucleic acid extraction of various virus culture fluids such as parvovirus vaccine, Newcastle disease virus fluid, Tembusu virus fluid, type C lung virus fluid, reovirus fluid, new reovirus fluid, avian adenovirus type 1 virus fluid, etc. Among them, Newcastle disease virus liquid, Tembusu virus liquid, C-type lung virus liquid, reovirus liquid, and new reovirus liquid are RNA viruses, and AMV reverse transcriptase XL from TaKaRa Company is used for reverse transcriptase according to the following 20 μL system. Transcript:
[0049] Template RNA 4μL;
[0050] 5×Reverse Transcriptase Ruffer 4μL;
[0051] DNTP Mixture (10mMeach) 2μL;
[0052] RNase Inhibitor 0.5 μL;
[0053]RadomPrimer (50 μM) 1 μL;
[0054] AMVRever Transcriptase 2μL;
[0055] DEPCH 2 O6.5 μL.
[0056] 10min at 25°C; 60min at 42°C; 15min at 72°C; store at 4°C. Using ZL in Example 1 as a positive control, the above-mentioned extracted DNA and the cDNA ...
Embodiment 3
[0057] Embodiment 3: Sensitivity experiment
[0058] Dilute the DNA extracted from the sample ZL in the above-mentioned embodiment 1, and dilute it to: 1×10 -1 , 1×10 -2 , 1×10 -3 , 1×10 -4 , 1×10 -5 , 1×10 -6 There are six gradients in total, the original DNA concentration is 12.79ng / μL, and the DNA amounts of 2μL template are: 2.558ng, 0.2558ng, 25.58pg, 2.558pg, 0.2558pg, 0.02558pg. Adopt PCR step program in embodiment 1, do PCR with primer of the present invention, from image 3 It can be seen that the extracted DNA is diluted to 100 times, and when the DNA content is 0.2558ng, the PCR detection is a strong positive, and when it is diluted to 1000 times, a weak positive can be detected when the DNA content is 25.58pg, indicating that the primers and PCR detection of the present invention The method can detect at least 0.2558ng of template DNA, and has good sensitivity.
[0059]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 