The application of net49 protein as a diabetes biomarker and therapeutic target
A technology for biomarkers and diabetes drugs, applied in biological testing, biomaterial analysis, medical preparations containing active ingredients, etc., can solve problems such as lack of effective drugs and treatment methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] The inventor collected the blood of non-diabetic and diabetic patients in the early stage, and sent the blood to the bio-detection laboratory of Boao Bio Co., Ltd. for Microarray data analysis. It was found that a large number of genes related to inflammatory response were expressed in diabetic patients. Elevated, such as TLR4, CD68, IL6, etc. ( figure 1 ). However, in the process of data analysis, the inventors found that the expression of NET49 (nucleolar complex associated protein 4homolog) decreased in diabetic patients ( figure 1 ).
Embodiment 2
[0027] Preliminary studies found that the expression of NET49 was regulated by lipopolysaccharide (LPS) and palmitic acid (PA);
[0028] The macrophage cell line Raw264.7 was cultured in DMEM medium (sigma) containing 10% fetal bovine serum (GIBCO) and seeded in 6-well plates at 2 x 106 after the cells were confluent. Raw264.716h was treated with LPS (sigma) at different concentrations of 0, 1, 10, 100, 1000, 10000 (ng / ml), and the cell pellet was collected. Cell pellets were lysed with RIPA lysis buffer, incubated on ice for 10 min, centrifuged at 12,000 rpm for 10 min, and the supernatant was collected. Take 40ug protein for SDS-PAGE electrophoresis, then transfer the protein to PVDF membrane by electrotransfer at 150mA3h; block the transferred PVDF membrane with 5% nonfat milk powder blocking solution at 4°C overnight; add NET49 antibody at 4°C Incubate overnight, wash three times with PBST (PBS buffer pH 7.4 containing 0.5 mL / L Tween-20), and then mix with 4000-fold dilut...
Embodiment 3
[0031] In order to further study the role of NET49 in mice, NET49 knockout mice were prepared by Nanjing Model Animal Center. The two ends of mouse exon3 were added with loxp sites and mated with the lymz-cre tool mouse with macrophage-specific knockout to obtain LKO mice with macrophage-specific knockout ( image 3 ).
[0032] Identify primers:
[0033] loxptF: GCCTTGTCATAGACCATGCGATCTG,
[0034] loxptR:TAAGATGCCAGACCGGGGCTTG;
[0035] FRTtR: ACAGAACTTGGCTTGAGGCATGTAC;
[0036] cre-f:GCCTGCATTACCGGTCGATGC;
[0037] cre-r: CAGGGGTGTTATAAGCAATCCC.
[0038] PCR program, 95°C 5min; 95°C 30s, 62.3°C 45s, 72°C 60s, 30 cycles; 72°C 10min.
[0039] The 6-week-old mice were fed with normal chow (CD) and high-fat chow (HFD, 60% kal, D12492, Reaearch Diets Inc) for 14 weeks, respectively, and the weight changes of the mice were recorded every week. Mice were fasted overnight and fasting blood glucose was measured. Glucose tolerance test (GTT), mice were fasted for 16 hours, and ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More