Recombinant vector for expressing histidine-tag-fused foreign gene in Kluyveromyces marxianus nutritional deficient strain

A recombinant vector, yeast nutrition technology, applied in the direction of recombinant DNA technology, the use of vectors to introduce foreign genetic material, fungi, etc., can solve the problems of low expression level, low growth density, unsuitable for edible protein, etc.

Inactive Publication Date: 2015-12-09
FUDAN UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the protein expression of Pichia pastoris needs to be induced by methanol, so it is not suitable for the production of edible protein
Saccharomyces cerevisiae is prone to ethanol production, with low growth density and low expression level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant vector for expressing histidine-tag-fused foreign gene in Kluyveromyces marxianus nutritional deficient strain
  • Recombinant vector for expressing histidine-tag-fused foreign gene in Kluyveromyces marxianus nutritional deficient strain
  • Recombinant vector for expressing histidine-tag-fused foreign gene in Kluyveromyces marxianus nutritional deficient strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Embodiment 1, construction of recombinant vector PUKD114

[0064] Step 1. Amplify the pUC19 plasmid

[0065] Forward primer:

[0066] 5'-GAGGGGTACCGAGCTCGAATTAGCTCGAATTCGTAATCATGTCATAGCTGTTTCCT-3'

[0067] Reverse primer: 5'-TACAATTTTATGGTGCACTTCTCAGTACAATCTGCT-3'

[0068] The pUC19 plasmid was amplified using the primers. The PCR amplification reaction was carried out according to the instruction manual of PhantaSuperFidelityDNA Polymerase of Vazyme Company, the annealing temperature was 58°C, the extension time was 3 minutes, and 30 cycles. The PCR product was named as fragment A.

[0069] Step 2, amplify the pcYGW of the Gateway system vector

[0070] Forward primer: 5'-GAGTGCACCATAAAATTGTAAACGTTAATATTTTG-3'

[0071] Reverse primer: 5'-GCAAGCTTGGCACTGGCCGTCGTTTTACAACGTCG-3'

[0072] The pcYGW of the Gateway system vector was amplified using the primers. PCR amplification conditions were the same as step 1, except that the extension time was 1 min. The PCR ...

Embodiment 2

[0120] Embodiment 2, construction of recombinant vector PUKD116

[0121] Step 1, referring to Example 1, construct the PUKDN112 recombinant vector.

[0122] Step 2, Mutating PUKDN112

[0123] The PUKDN112 plasmid was mutated according to the instructions of the QuikChangeII kit of Agilent. The primers used for mutation are:

[0124] 5'-ATAAGTGACACATTTAATTTTTTTTTTTGTTAGATACTAGTCCCGGGGCGGCCGCTCACCATCATCACCACCATTAAGGCCGCAAGCTTTGATCTGATCTGCTTACTTTAC-3';

[0125] 5'-GTAAAGTAAGCAGATCAGATCAAAGCTTGCGGCCTTAATGGTGGTGATGATGGTGAGCGGCCGCCCCGGGACTAGTATCTAACAAAAAAAAAATTAAATGTGTCACTTAT-3'.

[0126] The mutated plasmid is PUKDN116. PUKDN116 was sequenced by Jieli Company to determine the 6HisTag sequence and multiple cloning sites. The sequencing primers are:

[0127] 5'-TCCCTTGAATCGTGTTTGCCAGTT-3'.

[0128] refer to figure 2 , the sequencing results are as follows:

[0129] Full length: 11412bp

[0130] 1031-1171bp: beta-lactamase (ampicillin resistance gene)

[0131] 3112-7870p: ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant vector for expressing a histidine-tag-fused foreign gene in a Kluyveromyces marxianus nutritional deficient strain, and a preparation method and application of the recombinant vector. The recombinant vector sequentially comprises an ampicillin resistance gene, a PKD1 vector sequence, an inulase promotor, multiple cloning sites, an inulase terminator, a nutritional gene promotor and a nutritional gene open reading frame, and further comprises histidine tags located at C ends or N ends of the multiple cloning sites. The recombinant vector provided by the invention can be used for building a transformant to realize expression of the foreign gene.

Description

technical field [0001] The present invention relates to a recombinant vector for exogenous gene expression, in particular to a recombinant vector containing polyhistidine tag for exogenous gene secretion and expression in Kluyveromyces auxotrophic strains. Background technique [0002] Yeast is a single-celled eukaryote, which has both the characteristics of microorganisms and the protein synthesis and processing system of eukaryotes. Therefore, it is widely used to express a variety of foreign eukaryotic proteins. The current mainstream yeast expression systems include Pichia pastoris and Saccharomyces cerevisiae expression systems. However, the protein expression of Pichia pastoris needs to be induced by methanol, which is not suitable for the production of edible protein. Saccharomyces cerevisiae is prone to ethanol production, with low growth density and low expression level. Aiming at these series of problems, it is of great industrial value to develop a new yeast ex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19C12R1/645
Inventor吕红余垚袁汉英周峻岗李育阳
OwnerFUDAN UNIV