Check patentability & draft patents in minutes with Patsnap Eureka AI!

A kind of transgenic vector for primordial germ cell targeted mutation and preparation method and use

A technology of primordial germ cells and transgenic vectors, applied in the direction of using vectors to introduce foreign genetic material, cells modified by introducing foreign genetic material, animal husbandry, etc., can solve the problems of reducing germ cell mutation, increasing the difficulty of screening, etc. Cost and effort, reducing phenotypic effects, increasing embryo viability

Active Publication Date: 2019-04-02
INST OF AQUATIC LIFE ACAD SINICA
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the injection dose is reduced to reduce mutations, although somatic cell mutations can be reduced and embryos survive, germ cell mutations will also be reduced, increasing the difficulty of subsequent screening

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of transgenic vector for primordial germ cell targeted mutation and preparation method and use
  • A kind of transgenic vector for primordial germ cell targeted mutation and preparation method and use
  • A kind of transgenic vector for primordial germ cell targeted mutation and preparation method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] A transgenic vector pTol2 (UAS:Cas9) for targeted mutation of primordial germ cells, prepared by the following steps

[0041] 1. Design a transgenic line that specifically expresses Cas9 in zebrafish primordial germ cells based on the Gal4 / UAS system, see the strategy diagram figure 1 As shown, then design the primers needed to amplify each fragment in the transgenic vector. The primer sequences are shown in the table below:

[0042]

[0043] 2. Construction of the transgenic vector pTol2 (UAS:Cas9).

[0044] The plasmids pBK-KalTA4 (Distel, M., Wullimann, M.F. and Koster, R.W. (2009). Optimized Gal4 genetics for permanent gene expression mapping inzebrafish. Proc Natl Acad Sci U S A 106, 13365-70.) and pGH-T7- zCas9 (Liu, D., Wang, Z., Xiao, A., Zhang, Y., Li, W., Zu, Y., Yao, S., Lin, S. and Zhang, B. (2014). Efficient gene targeting in zebrafish mediated by a zebrafish-codon-optimized cas9 and evaluation of off-targeting effect. J Genet Genomics 41,43-6.) as a ...

Embodiment 2

[0052] A method for preparing a transgenic zebrafish Tg (UAS:Cas9) strain, comprising:

[0053] Tol2 transposase mRNA was synthesized using Ambion's MACHINE in vitro transcription kit, and then the transgenic vector pTol2 (UAS:Cas9) was mixed with the Tol2 transposase mRNA synthesized by in vitro transcription at a ratio of 1:5 (total concentration 100ng / l) , and introduced it into single-cell stage zebrafish embryos by microinjection to obtain P0 generation transgenic fry.

[0054] Collect P0 generation embryos, use primers F: GATCCCATCGCGTCTCAG, R: CCCAGCCCACGCTATTTG, and perform PCR to detect the transmission of the transgene. The amplification conditions are: 95°C for 4 minutes; 95°C for 30 seconds; 57°C for 30 seconds; 72°C Extend for 90 seconds, 30 cycles; extend at 72°C for 10 minutes; store at 4°C.

[0055] The F1 generation was bred by crossing the P0 generation of positive individuals with the wild-type zebrafish. The F1 population was cultured to sexual maturity, ...

Embodiment 3

[0057] Embryos of Tg(kop:KalTA4) females and Tg(UAS:Cas9) males specifically express Cas9 in primordial germ cells:

[0058] 1. In situ hybridization detection Cas9 was specifically expressed in primordial germ cells in embryos hybridized between Tg(kop:KalTA4) female fish and Tg(UAS:Cas9) male fish.

[0059] (1) Cas9 probe preparation.

[0060] A. Template preparation and purification.

[0061] Using the plasmid pTol2 (UAS:Cas9) as a template, zCas9-probe-F: ACTGAAAGGAAGCCCCGAG and T3-nanos3-R: GATCCATTAACCCTCACTAAAGGGAATCTCCCGGAGCATCAAT as primers, PCR amplified the template DNA, and the PCR product was recovered by referring to the PCR clean up kit from Axygen Company, and It serves as a probe for synthetic probes.

[0062] B. Probe synthesis and recovery.

[0063] RNA probes were transcribed and synthesized according to the instructions of Promega's T3 RNA polymerase, and the probes were recovered according to the instructions of sigma spin post-reaction chean-up column...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transgenic vector for target mutation of primordial germ cells, a method for preparing the transgenic vector and application thereof. The transgenic vector, the method and the application have the advantages that the vector pTol2 (UAS: Cas9) is introduced into zebrafish embryos at unicellular stages to obtain strains Tg (UAS: Cas9) and strains Tg (kop: KalTA4), and Cas9 genes can be efficiently, specifically and continuously expressed in the primordial germ cells of zebrafishes by hybrid embryos obtained after fishes of the strains Tg (UAS: Cas9) and female fishes of the strains Tg (kop: KalTA4) are hybridized; the hybrid embryos of the male fishes of the strains Tg (UAS: Cas9) and the female fishes of the strains (kop: KalTA4) are used as receptor embryos when mutation strains are about to be prepared, somatic mutation can be effectively reduced after gRNA [guide RNA (ribonucleic acid)] of target genes is directly injected, accordingly, the survival rate of the injected P0-generation embryos can be increased, P0-generation adult fishes can effectively pass on mutation, and accordingly the transgenic vector and the method have broad application prospects.

Description

technical field [0001] The invention belongs to the technical field of fish bioengineering, and in particular relates to a transgene carrier for targeted mutation of primordial germ cells, a preparation method and application. Background technique [0002] Gene editing technology is an important research tool to reveal gene function (Esvelt, K.M. and Wang, H.H. (2013). Genome-scale engineering for systems and synthetic biology. Mol SystBiol 9, 641.). In recent years, genome editing technologies based on endonucleases have emerged successively, such as: Zinc-finger nucleases (ZFNs) (Bibikova, M., Beumer, K., Trautman, J.K. and Carroll, D. ( 2003).Enhancing gene targeting with designed zinc fingernucleases.Science 300,764.), Transcription activator like effector nucleases (TALENs) (Bedell, V.M., Wang, Y., Campbell, J.M., Poshusta, T.L., Starker, C.G., Krug, R.G., 2nd, Tan, W., Penheiter, S.G., Ma, A.C., Leung, A.Y. et al. (2012). In vivo genome editing using a high-efficiency...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/66C12N5/10A01K67/027
Inventor 熊凤孙永华叶鼎朱作言
Owner INST OF AQUATIC LIFE ACAD SINICA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More