Transgenic vector for target mutation of primordial germ cells, method for preparing transgenic vector and application thereof

A technology of primordial germ cells and transgenic vectors, applied in the direction of using vectors to introduce foreign genetic material, cells modified by introducing foreign genetic material, recombinant DNA technology, etc. The effect of saving cost and effort, reducing phenotypic effects, and increasing embryo survival rate

Active Publication Date: 2016-01-27
INST OF AQUATIC LIFE ACAD SINICA
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the injection dose is reduced to reduce mutations, although somatic cell mutations can be reduced and embryos survive, germ cell mutations will also be reduced, increasing the difficulty of subsequent screening

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic vector for target mutation of primordial germ cells, method for preparing transgenic vector and application thereof
  • Transgenic vector for target mutation of primordial germ cells, method for preparing transgenic vector and application thereof
  • Transgenic vector for target mutation of primordial germ cells, method for preparing transgenic vector and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] A transgenic vector pTol2 (UAS:Cas9) for targeted mutation of primordial germ cells, prepared by the following steps

[0041] 1. Design a transgenic line that specifically expresses Cas9 in zebrafish primordial germ cells based on the Gal4 / UAS system, see the strategy diagram figure 1 As shown, then design the primers needed to amplify each fragment in the transgenic vector. The primer sequences are shown in the table below:

[0042]

[0043] 2. Construction of the transgenic vector pTol2 (UAS:Cas9).

[0044] The plasmids pBK-KalTA4 (Distel, M., Wullimann, M.F. and Koster, R.W. (2009). Optimized Gal4 genetics for permanent gene expression mapping inzebrafish. ProcNatlAcadSciUSA106, 13365-70.) and pGH-T7-zCas9 (Liu, D., Wang, Z., Xiao, A., Zhang, Y., Li, W., Zu, Y., Yao, S., Lin, S. and Zhang, B. (2014). Efficient gene targeting in zebra fish mediated by aze bra fish-codon-optimized cas 9 and evaluation of off-targeting effect. J Genet Genomics 41, 43-6.) As a temp...

Embodiment 2

[0052] A method for preparing a transgenic zebrafish Tg (UAS:Cas9) strain, comprising:

[0053] Tol2 transposase mRNA was synthesized using Ambion's MACHINE in vitro transcription kit, and then the transgenic vector pTol2 (UAS:Cas9) was mixed with the Tol2 transposase mRNA synthesized by in vitro transcription at a ratio of 1:5 (total concentration 100ng / l) , and introduced it into single-cell stage zebrafish embryos by microinjection to obtain P0 generation transgenic fry.

[0054] Collect P0 generation embryos, use primers F: GATCCCATCGCGTCTCAG, R: CCCAGCCCACGCTATTTG, and perform PCR to detect the transmission of the transgene. The amplification conditions are: 95°C for 4 minutes; 95°C for 30 seconds; 57°C for 30 seconds; 72°C Extend for 90 seconds, 30 cycles; extend at 72°C for 10 minutes; store at 4°C.

[0055] The F1 generation was bred by crossing the P0 generation of positive individuals with the wild-type zebrafish. The F1 population was cultured to sexual maturity, ...

Embodiment 3

[0057] Embryos of Tg(kop:KalTA4) females and Tg(UAS:Cas9) males specifically express Cas9 in primordial germ cells:

[0058] 1. In situ hybridization detection Cas9 was specifically expressed in primordial germ cells in embryos hybridized between Tg(kop:KalTA4) female fish and Tg(UAS:Cas9) male fish.

[0059] (1) Cas9 probe preparation.

[0060] A. Template preparation and purification.

[0061] Using plasmid pTol2 (UAS:Cas9) as template, zCas9-probe-F: ACTGAAAGGAAGCCCCGAG and T3-nanos3-R: GATCCATTAACCCTCACTAAAGGGAATCTCCCGGAGCATCAAT as primers, PCR amplified template DNA, referring to Axygen’s PCRcleanup kit to recover the PCR product, which was used as Synthetic probes for probes.

[0062] B. Probe synthesis and recovery.

[0063] RNA probes were transcribed and synthesized according to Promega's T3 RNA polymerase instructions, and the probes were recovered according to the instructions of sigmaspinpost-reactionchean-upcolumns.

[0064] (2) In situ hybridization was used ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a transgenic vector for target mutation of primordial germ cells, a method for preparing the transgenic vector and application thereof. The transgenic vector, the method and the application have the advantages that the vector pTol2 (UAS: Cas9) is introduced into zebrafish embryos at unicellular stages to obtain strains Tg (UAS: Cas9) and strains Tg (kop: KalTA4), and Cas9 genes can be efficiently, specifically and continuously expressed in the primordial germ cells of zebrafishes by hybrid embryos obtained after fishes of the strains Tg (UAS: Cas9) and female fishes of the strains Tg (kop: KalTA4) are hybridized; the hybrid embryos of the male fishes of the strains Tg (UAS: Cas9) and the female fishes of the strains (kop: KalTA4) are used as receptor embryos when mutation strains are about to be prepared, somatic mutation can be effectively reduced after gRNA [guide RNA (ribonucleic acid)] of target genes is directly injected, accordingly, the survival rate of the injected P0-generation embryos can be increased, P0-generation adult fishes can effectively pass on mutation, and accordingly the transgenic vector and the method have broad application prospects.

Description

technical field [0001] The invention belongs to the technical field of fish bioengineering, and in particular relates to a transgene carrier for targeted mutation of primordial germ cells, a preparation method and application. Background technique [0002] Gene editing technology is an important research tool to reveal gene function (Esvelt, K.M. and Wang, H.H. (2013). Genome-scale engineering for systems and synthetic biology. Mol Syst Biol 9, 641.). In recent years, genome editing technologies based on endonucleases have emerged successively, such as: Zinc-finger ribonucleases (Zinc-fingernucleases, ZFNs) (Bibikova, M., Beumer, K., Trautman, J.K. and Carroll, D. (2003 ). Enhancing gene targeting with designed zinc finger nucleases. Science 300,764.), Transcription activator like effector nucleases (Transcription activator like effector nucleases, TALENs) (Bedell, V.M., Wang, Y., Campbell, J.M., Poshusta, T.L., Starker, C.G., Krug, R.G., 2nd , Tan, W., Penheiter, S.G., Ma,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N15/66C12N5/10A01K67/027
Inventor 熊凤孙永华叶鼎朱作言
Owner INST OF AQUATIC LIFE ACAD SINICA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap