Preparation method and enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag
A tumor antigen, 3h11ag technology, applied in the field of biomedicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Preparation of 3H11Ag
[0063] 1. Obtaining of 69kD3H11Ag protein fragment:
[0064] Using the clinical primary gastric cancer tissue cDNA as a template, design primers:
[0065] Upstream primer 5'GAAGTAAATGAGCTAAAAAGTG;
[0066] Downstream primer 5'CTGAAATTTGGCTATCACTGTC.
[0067] The 36th to 634th amino acid sequence of CEP290 (SEQ ID No. 1) was amplified.
[0068] PCR100ul system: 10×PCRbuffer10ul, Mg 2+ 6ul, dNTP8ul, primer-F0.5ul, primer-R0.5ul, ddH2O72.5ul, rTaq2ul, DNA template 0.5ul.
[0069] PCR conditions: denaturation at 95 degrees for 30 seconds; annealing at 55 degrees for 30 seconds; extension at 72 degrees for 2 minutes. A total of 25 cycles. After that, keep it at 72 degrees for 30 minutes. After the PCR is over, store at 4 degrees.
[0070] PCR amplification products were verified by nucleic acid gel, indicating that the amplification was successful.
[0071] The present invention has made a lot of attempts to select and optimize the expression...
Embodiment 2
[0096] Preparation of polyclonal antibody against 3H11Ag
[0097] 1. Animal immunity:
[0098] The 3H11Ag prepared in Example 1 was mixed with Freund's complete adjuvant and Freund's incomplete adjuvant at a mass ratio of 1:1 to prepare a mixture.
[0099] New Zealand white rabbits were used as immunized animals.
[0100] The first immunization: subcutaneous injection of a 1:1 mixture of antigen and Freund's complete adjuvant on the back of the rabbit, the total amount of antigen injected was 1 mg. In order to prevent immune tolerance, inject at eight points on both sides of the back and spine.
[0101] The second immunization: 10 days after the first immunization, a 1:1 mixture of antigen and Freund's incomplete adjuvant was subcutaneously injected into the back of the rabbit, and the total amount of antigen injected was 0.5 mg.
[0102] The third immunization: same as the second immunization.
[0103] The last immunization: In order to increase the titer, 1 mg of 3H11Ag ...
Embodiment 3
[0125] Preparation of 3H11AgELISA detection kit
[0126] 1. Reagents used:
[0127] (1) Coating solution (pH7.40.2MPBS buffer): NaCl8.18g, KCl0.201g, NaCl 2 HPO 4 12H 2 O3.58g, KH 2 PO 4 0.228g, add double distilled water to 1000ml, adjust pH to 7.4, and then dilute 5 times.
[0128] (2) Diluent (pH7.41MPBS buffer): NaCl8.18g, KCl0.201g, NaCl 2 HPO 4 12H 2 O3.58g, KH 2 PO 4 0.228g, add double distilled water to 1000ml, adjust pH to 7.4.
[0129] (3) Blocking solution (3% BSA / PBS solution): BSA300mg, 1MpH7.4PBS10ml.
[0130] (4) Washing solution (PBST): 0.05% PBST, that is, 1 M PBS at pH 7.4, containing 0.05% Tween 20.
[0131] (5) Enzyme-labeled secondary antibody (HRP-labeled goat anti-rabbit polyclonal antibody): horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG purchased from Millipore, USA, used with 1M PBS pH7.4 according to 1: 10000 dilution.
[0132] (6) 3H11Ag protein standard: the 1MPBS solution of 69kD 3H11Ag protein prepared in Example 1, pH7.4...
PUM
Property | Measurement | Unit |
---|---|---|
concentration | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com