Preparation method and enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag

A tumor antigen, 3h11ag technology, applied in the field of biomedicine

Active Publication Date: 2016-02-03
福建亿彤生物科技有限公司
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the 3H11Ag tumor antigen comes from an intracellular protein, when some cells become malignant, it can be expressed on the surface of malignant cells and tissues. Whether the 3H11Ag tumor antigen also exists in the supernatant of tumor cell culture and the serum of tumor patients has not yet been determined. to report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag
  • Preparation method and enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag
  • Preparation method and enzyme-linked immunosorbent assay kit of human tumor antigen 3H11Ag

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Preparation of 3H11Ag

[0063] 1. Obtaining of 69kD3H11Ag protein fragment:

[0064] Using the clinical primary gastric cancer tissue cDNA as a template, design primers:

[0065] Upstream primer 5'GAAGTAAATGAGCTAAAAAGTG;

[0066] Downstream primer 5'CTGAAATTTGGCTATCACTGTC.

[0067] The 36th to 634th amino acid sequence of CEP290 (SEQ ID No. 1) was amplified.

[0068] PCR100ul system: 10×PCRbuffer10ul, Mg 2+ 6ul, dNTP8ul, primer-F0.5ul, primer-R0.5ul, ddH2O72.5ul, rTaq2ul, DNA template 0.5ul.

[0069] PCR conditions: denaturation at 95 degrees for 30 seconds; annealing at 55 degrees for 30 seconds; extension at 72 degrees for 2 minutes. A total of 25 cycles. After that, keep it at 72 degrees for 30 minutes. After the PCR is over, store at 4 degrees.

[0070] PCR amplification products were verified by nucleic acid gel, indicating that the amplification was successful.

[0071] The present invention has made a lot of attempts to select and optimize the expression...

Embodiment 2

[0096] Preparation of polyclonal antibody against 3H11Ag

[0097] 1. Animal immunity:

[0098] The 3H11Ag prepared in Example 1 was mixed with Freund's complete adjuvant and Freund's incomplete adjuvant at a mass ratio of 1:1 to prepare a mixture.

[0099] New Zealand white rabbits were used as immunized animals.

[0100] The first immunization: subcutaneous injection of a 1:1 mixture of antigen and Freund's complete adjuvant on the back of the rabbit, the total amount of antigen injected was 1 mg. In order to prevent immune tolerance, inject at eight points on both sides of the back and spine.

[0101] The second immunization: 10 days after the first immunization, a 1:1 mixture of antigen and Freund's incomplete adjuvant was subcutaneously injected into the back of the rabbit, and the total amount of antigen injected was 0.5 mg.

[0102] The third immunization: same as the second immunization.

[0103] The last immunization: In order to increase the titer, 1 mg of 3H11Ag ...

Embodiment 3

[0125] Preparation of 3H11AgELISA detection kit

[0126] 1. Reagents used:

[0127] (1) Coating solution (pH7.40.2MPBS buffer): NaCl8.18g, KCl0.201g, NaCl 2 HPO 4 12H 2 O3.58g, KH 2 PO 4 0.228g, add double distilled water to 1000ml, adjust pH to 7.4, and then dilute 5 times.

[0128] (2) Diluent (pH7.41MPBS buffer): NaCl8.18g, KCl0.201g, NaCl 2 HPO 4 12H 2 O3.58g, KH 2 PO 4 0.228g, add double distilled water to 1000ml, adjust pH to 7.4.

[0129] (3) Blocking solution (3% BSA / PBS solution): BSA300mg, 1MpH7.4PBS10ml.

[0130] (4) Washing solution (PBST): 0.05% PBST, that is, 1 M PBS at pH 7.4, containing 0.05% Tween 20.

[0131] (5) Enzyme-labeled secondary antibody (HRP-labeled goat anti-rabbit polyclonal antibody): horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG purchased from Millipore, USA, used with 1M PBS pH7.4 according to 1: 10000 dilution.

[0132] (6) 3H11Ag protein standard: the 1MPBS solution of 69kD 3H11Ag protein prepared in Example 1, pH7.4...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to view more

Abstract

A high-solubility and high-expression tumor antigen 3H11Ag protein is prepared by virtue of a molecular cloning method, and a corresponding polyclonal antibody is prepared by virtue of immune animal purification. On this basis, an ELISA kit capable of detecting 3H11Ag is prepared by taking a monoclonal antibody, the polyclonal antibody and an antigen protein of the antigen as main active components. According to the kit, a method for rapidly, simply and conveniently determining the protein concentration of 3H11Ag in supernatant of tumor cells is provided; the kit can be applied to the scientific research or the clinical diagnosis of relevant diseases of cancers.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and specifically relates to a preparation method of human tumor antigen 3H11Ag, the design of an enzyme-linked immunoassay kit for detecting the antigen, and a preparation method thereof. Background technique [0002] Immunoassay is an analysis method based on the specific recognition reaction of antigens and antibodies. It can be used to label antigens or antibodies (such as enzymes, fluorescent substances, radioactive isotope labels, etc.) Combining technologies, it can perform qualitative and quantitative determination of specific target substances in samples, which has the characteristics of strong specificity, high sensitivity, convenient method, low cost, systematization and commercialization. [0003] The basic principle of enzyme-linked immunosorbent assay (ELISA) is that the enzyme molecule is covalently bound to the antibody or anti-antibody molecule. This combination will not chang...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C07K16/30C07K16/06G01N33/68G01N33/574G01N33/543
Inventor 石宁陈鹤谢捷明李博文邓翠敏
Owner 福建亿彤生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap