Unlock instant, AI-driven research and patent intelligence for your innovation.

Bastard halibut primordial germ cell dead end gene and application thereof

A technology of primordial germ cells and flounder, applied in application, gene therapy, genetic engineering, etc., can solve problems such as gene function loss and repressed genes

Inactive Publication Date: 2016-06-01
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This technology artificially introduces dsRNA with a homologous sequence to the target gene, and the host cell immediately responds to these dsRNAs, and the endonuclease Dicer in the cytoplasm cuts the dsRNA into multiple small fragments of RNA with specific length and structure (about 21~23bp), that is, siRNA, finally induces the mRNA degradation of the target gene, thereby achieving the repression of gene expression, and then the loss of gene function

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bastard halibut primordial germ cell dead end gene and application thereof
  • Bastard halibut primordial germ cell dead end gene and application thereof
  • Bastard halibut primordial germ cell dead end gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1. RNA extraction

[0023] The total RNA of flounder gonads was extracted with Trizol (Invitrogen), and the specific steps were as follows: Take about 0.1 mg of flounder gonads, add 0.1 mL Trizol, mix thoroughly, then add 0.9 mL Trizol, and place at room temperature for 5 min. Add 0.2 mL of chloroform, shake vigorously for 15 s, and place at room temperature for 3 min. 12000×g, 4°C, centrifuge for 15 minutes, and carefully take out the centrifuge tube after centrifugation. Take the supernatant into a new centrifuge tube, add an equal volume of isopropanol, mix well, place at room temperature for 10 min, centrifuge at 12000×g, 4°C for 10 min. Remove the isopropanol, add 1 mL of pre-cooled 75% ethanol to wash the precipitate, centrifuge at 7500×g, 4°C for 5 min. Remove the ethanol and place it in an ultra-clean bench to volatilize the ethanol. Add 30 μL of water (RNase-free), bathe at 55-60°C for 10 minutes to dissolve the RNA, take it out and put it on ice. Add 1 μL ...

Embodiment 2

[0051] According to the nucleotide sequence shown in the above-mentioned SEQIDNo.1, those skilled in the art can obtain siRNA through artificial chemical synthesis; that is, the Sense (5'-3') sequence of the siRNA sequence is: CCACCUGAGGGUUCUGCGUG; Antisense (5'-3 ') sequence is: CACGCAGAACCCUCAGGUGG.

[0052] Then based on the 20bp siRNA sequence obtained above as the core sequence, modify according to the prior art to obtain 25bpsiRNA, wherein the Sense (5'-3') sequence is: ACCACCUGAGGGUUCUGCGUGUGCU; Antisense (5'-3') sequence is: AGCACACGCAGAACCCUCAGGUGGU .

[0053] At the same time, it can also be obtained by biological synthesis.

[0054] And set the same length of control siRNA, wherein the Sense (5'-3') sequence is: UAAAUGUACUGCGCGUGGAGAGGAA; Antisense (5'-3') sequence is: UUCCUCUCCACGCGCAGUACAUUUA.

Embodiment 3

[0056] 1. Injection of siRNA and sample collection

[0057] The DndsiRNA (25bpsiRNA) obtained above and its control siRNA were injected into 48-day-old (1.9-2.2cm) flounder juveniles, anesthetized with MS222 and measured for body weight before injection, and injected at a dose of 0.2nmol / g. Afterwards, they were cultured in seawater with a temperature range of 18-24°C, filled with air, and raised normally. After 120 days, they were anesthetized, measured for body length and separated from the gonads.

[0058] 2. Extraction of RNA

[0059] Same as step 1 of implementation case 1

[0060] 3. Synthesis of cDNA and detection

[0061] Same as step 2 of implementation case 1

[0062] 4. Detection of the efficiency of inhibiting target genes

[0063] Whether the expression of the target gene was reduced or completely inhibited was detected by PCR, and the primers used were as follows: 5' primer 5'-CACCTGAGGGTTCTG-3', 3' primer 5'-CAGTGATGCTCCTGAGTAAG-3'.

[0064] The PCR mixture...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bastard halibut dead end sequence, in particular to a bastard halibut primordial germ cell dead end gene and application thereof. The bastard halibut Dead end gene is shown as SEQ ID No.1. siRNA of the bastard halibut dead end gene is siRNA of 20-50 bp. A sequence of Dead end (Dnd) is acquired in bastard halibut, and the siRNA synthesized by using the sequence as a target gene has growth promoting effect, so that the sequence and related siRNA have extremely high value in application of promoting growth of fishes including seawater fishes, and a basic technical guarantee is provided for study related to growth promoting of the fishes including the seawater fishes. In addition, the gene sequence is a sequence unique to bastard halibut, so that growth of the seawater fishes like bastard halibut can be promoted.

Description

technical field [0001] The invention relates to the deadend sequence of the flounder, in particular to a deadend gene of the flounder primordial germ cell and the application thereof. Background technique [0002] Flounder, commonly known as tooth slices, is a flounder fish, which belongs to the order Pleurotus, family Flounder, and genus Flounder. It is an important marine cultured fish in my country, Japan, South Korea and other countries. The rapid growth of flounder can improve the breeding efficiency and reduce various risks in the long-term breeding process. It takes a long time to obtain fast-growing lines through genetic breeding techniques. How to use small molecular substances to promote its growth has not been reported. [0003] Deadend (Dnd) is a germ plasm component unique to vertebrates. It is a marker gene for primordial germ cells (PGCs) and gonadal germ cells. It participates in the occurrence, development, migration, survival and other functions of PGCs. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/113A61K48/00A61K31/713
CPCC07K14/461C12N15/113C12N2310/141
Inventor 谭训刚隋玉嫘焦爽吴志昊李美洁邹玉霞梁冬冬尤锋
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI