Bastard halibut primordial germ cell dead end gene and application thereof
A technology of primordial germ cells and flounder, applied in application, gene therapy, genetic engineering, etc., can solve problems such as gene function loss and repressed genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] 1. RNA extraction
[0023] The total RNA of flounder gonads was extracted with Trizol (Invitrogen), and the specific steps were as follows: Take about 0.1 mg of flounder gonads, add 0.1 mL Trizol, mix thoroughly, then add 0.9 mL Trizol, and place at room temperature for 5 min. Add 0.2 mL of chloroform, shake vigorously for 15 s, and place at room temperature for 3 min. 12000×g, 4°C, centrifuge for 15 minutes, and carefully take out the centrifuge tube after centrifugation. Take the supernatant into a new centrifuge tube, add an equal volume of isopropanol, mix well, place at room temperature for 10 min, centrifuge at 12000×g, 4°C for 10 min. Remove the isopropanol, add 1 mL of pre-cooled 75% ethanol to wash the precipitate, centrifuge at 7500×g, 4°C for 5 min. Remove the ethanol and place it in an ultra-clean bench to volatilize the ethanol. Add 30 μL of water (RNase-free), bathe at 55-60°C for 10 minutes to dissolve the RNA, take it out and put it on ice. Add 1 μL ...
Embodiment 2
[0051] According to the nucleotide sequence shown in the above-mentioned SEQIDNo.1, those skilled in the art can obtain siRNA through artificial chemical synthesis; that is, the Sense (5'-3') sequence of the siRNA sequence is: CCACCUGAGGGUUCUGCGUG; Antisense (5'-3 ') sequence is: CACGCAGAACCCUCAGGUGG.
[0052] Then based on the 20bp siRNA sequence obtained above as the core sequence, modify according to the prior art to obtain 25bpsiRNA, wherein the Sense (5'-3') sequence is: ACCACCUGAGGGUUCUGCGUGUGCU; Antisense (5'-3') sequence is: AGCACACGCAGAACCCUCAGGUGGU .
[0053] At the same time, it can also be obtained by biological synthesis.
[0054] And set the same length of control siRNA, wherein the Sense (5'-3') sequence is: UAAAUGUACUGCGCGUGGAGAGGAA; Antisense (5'-3') sequence is: UUCCUCUCCACGCGCAGUACAUUUA.
Embodiment 3
[0056] 1. Injection of siRNA and sample collection
[0057] The DndsiRNA (25bpsiRNA) obtained above and its control siRNA were injected into 48-day-old (1.9-2.2cm) flounder juveniles, anesthetized with MS222 and measured for body weight before injection, and injected at a dose of 0.2nmol / g. Afterwards, they were cultured in seawater with a temperature range of 18-24°C, filled with air, and raised normally. After 120 days, they were anesthetized, measured for body length and separated from the gonads.
[0058] 2. Extraction of RNA
[0059] Same as step 1 of implementation case 1
[0060] 3. Synthesis of cDNA and detection
[0061] Same as step 2 of implementation case 1
[0062] 4. Detection of the efficiency of inhibiting target genes
[0063] Whether the expression of the target gene was reduced or completely inhibited was detected by PCR, and the primers used were as follows: 5' primer 5'-CACCTGAGGGTTCTG-3', 3' primer 5'-CAGTGATGCTCCTGAGTAAG-3'.
[0064] The PCR mixture...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 