Recombinant human endostatin protein with different amino acid structures, method for preparing recombinant human endostatin protein and application thereof

A technology of endostatin and amino acids, applied in the field of genetic engineering, can solve the problems of single-drug administration and high probability of antibody production

Active Publication Date: 2016-06-08
点斗基因科技(南京)有限公司
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The 184-amino-acid endostatin expressed by American yeast was the first to enter clinical research in the world. In June 1999, the FDA approved the EntreMed clinical trial application, and the phase I clinical trial was initiated. It is currently staying in the phase II clinical research. The main reason is the probability of antibody production. High, indication selection and subcutaneous single drug administration

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human endostatin protein with different amino acid structures, method for preparing recombinant human endostatin protein and application thereof
  • Recombinant human endostatin protein with different amino acid structures, method for preparing recombinant human endostatin protein and application thereof
  • Recombinant human endostatin protein with different amino acid structures, method for preparing recombinant human endostatin protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The genetically engineered recombinant protein of embodiment 1 recombinant plasmid pET9c-En1 and its preparation method

[0051] This patent shows the comparison of the amino acid sequence and nucleotide sequence encoding prokaryotic expression endostatin 1 with the endostatin that has been approved for invention patent or approved for clinical research as a drug.

[0052] The sequence of PCR primers in the genetically engineered recombinant protein of the recombinant plasmid pET9c-En1 and its preparation method is as follows:

[0053] Primer (1): ATTCATATGCGCCGCCGCCGCCGCCGCCGCCGCCGCCACAGCCACCGCGACTTCCAG (SEQ ID NO.8)

[0054] Primer (2): GCCGGATCCCTACTTGGAGGCAGTCATGAAGCT (SEQ ID NO.9)

[0055] The primers for the PCR reaction were synthesized by Shanghai Sangon Company, using the endostatin nucleotide sequence in Xu Genxing Zl97107112.8 invention patent as shown in SEQ ID NO.7 as a template, adding the above two primers and conventional PCR reaction reagents, PCR reac...

Embodiment 2

[0058] The genetically engineered recombinant protein of embodiment 2 recombinant plasmid pET9c-En2 and its preparation method

[0059] This patent shows the comparison of the amino acid sequence and nucleotide sequence encoding the prokaryotic expression recombinant human endostatin protein 2 with Example 1 and the endostatin that has been approved for invention patents or approved for clinical research as a drug.

[0060] The sequence of PCR primers in the genetically engineered recombinant protein of the recombinant plasmid pET9c-En2 and its preparation method is as follows:

[0061] Primer (3) CATATGCGCCGCCGCCGCCGCCGCCGCCGCCGCCACAGCCACCGCGACTTCC (SEQ ID NO.10)

[0062] Primer (4) GCGGCATGCGGGGCGATCGCGGGGACTTCCAGTGCTTCC (SEQ ID NO.11)

[0063] Primer (5) GGAAGCACTGGAAGTCCCCGCGATCGCCCCGCATGCCGC (SEQ ID NO.12)

[0064] Primer (6) GTGGCATGGCTCGGACGCAAACGGGCGCAGGCTG (SEQ ID NO.13)

[0065] Primer (7) CAGCCTGCGCCCGTTTGCGTCCGAGCCATGCCAC (SEQ ID NO.14)

[0066] The primers of ...

Embodiment 3

[0067] Embodiment 3 Genetic engineering recombinant protein of recombinant plasmid pMAL-c2-En1 and pMAL-c2-En2 and preparation method thereof

[0068] Primer (8) CCGGAATTCCGCCGCCGCCGCCGCCGCCGCCGCCGCCAC (SEQ ID NO.15)

[0069] According to the method of Example 1, the endostatin nucleotide sequence of pET9c-En1 and the endostatin nucleotide sequence of pET9c-En2 were respectively used as templates, and primers (8) and primers (2) were respectively added to conventional PCR reactions The reagents were used for PCR, and the obtained PCR product and the purified pMAL-c2 vector were respectively digested with EcoRI and BamHI, and cloned according to the method in Example 1 to obtain pMAL-c2-En1 and pMAL-c2-En2 plasmids. Transform the empty vector pMAL-c2 and the recombinant plasmids pMAL-c2-En1 and pMAL-c2-En2 into E.coliBL21(DE3) respectively, inoculate them in LB medium containing 100 μg / mL penicillin, and wait for them to grow to OD 600When it was 0.4-0.6, IPTG (final concentra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant human endostatin protein with different amino acid structures, a method for preparing the recombinant human endostatin protein and application thereof. Amino acid sequences of a recombinant human endostatin protein 1 are shown as SEQ ID NO.1, and amino acid sequences of a recombinant human endostatin protein 2 are shown as SEQ ID NO.2. The recombinant human endostatin protein, the method and the application have the advantages that the two types of recombinant proteins are active in the aspects of inhibiting the proliferation activity of vascular endothelial cells under the induction actions of basic fibroblast growth factors (bFGF) and inhibiting the angiogenesis activity of chick chorioallantoic membranes (CAM) and are easy to enter the vascular endothelial cells and vascular endothelial cells of the chick chorioallantoic membranes, and transmembrane effects of the recombinant human endostatin protein and the structural stability of N ends can be obviously improved; effects of directly inhibiting tumor cell growth can be realized, effects of inhibiting generation of neonatal vascular endothelial cells can be effectively realized, and the recombinant human endostatin protein can be used for treating various diseases, including solid tumor, retinal diseases due to diabetes mellitus and rheumatoid arthritis, due to angiogenesis.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to the preparation of recombinant human endostatin protein with multiple different amino acid structures with the activity of inhibiting endothelial cell growth or tumor cell growth by genetic engineering method and its preparation method and application. Background technique [0002] In 1997, Harvard University O'Reilly et al. found that the culture medium of the mouse hemangioendothelial tumor (EOMA) cell line can inhibit the proliferation of vascular endothelial cells. A new protein was obtained through separation and purification, which was named endostatin in mice, and was later translated into endostatin (referred to as endostatin). On September 10, 1997, Xu Genxing and others applied for the invention patent of human endostatin (Zl97107112.8), and obtained the invention patent authorization on January 10, 2001. This is one of the earliest authorized patents for e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/78C07K19/00C12N15/12C12N15/62C12N15/70C12N15/85C12N15/81C12N15/66A61K38/39A61K47/48A61P35/00C12R1/84
CPCA61K38/00C07K14/78C07K2319/31C12N15/66C12N15/70C12N15/815C12N15/85C12N2800/101C12N2800/102C12N2800/107
Inventor徐根兴
Owner点斗基因科技(南京)有限公司