Method for fast identifying type of gene alternative splicing and application thereof

A gene and variable technology, applied in the field of identifying the alternative splicing type of a specific gene in eukaryotes at a specific time in a specific tissue, can solve the problem of inability to quickly determine the alternative splicing type of a gene, and achieve short identification time and experimental steps. Less, the result is easy to interpret

Inactive Publication Date: 2016-08-03
HUNAN UNIV OF SCI & TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] However, the above methods cannot quickly determine the type of gene alternative splicing, so providing a fast and simple method for identifying the type of gene alternative splicing is an important problem to be solved urgently

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for fast identifying type of gene alternative splicing and application thereof
  • Method for fast identifying type of gene alternative splicing and application thereof
  • Method for fast identifying type of gene alternative splicing and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1 Rapid identification of the alternative splicing type of the test chicken MHC I gene

[0057] Take the detection of the alternative splicing type of the chicken MHC I gene as an example: all the alternative splicing types of the chicken MHC I gene obtained from the GenBank database and literature retrieval and / or other methods (such as through other known experimental methods), and then design a suitable The primer pair is used to amplify all the alternative splicing types of the chicken MHC I gene by real-time fluorescent quantitative PCR, and their melting temperatures are obtained respectively, so that the standard melting temperature curve library of the gene is constructed, and the chicken The steps of MHCⅠgene standard melting temperature curve library are as follows:

[0058] (1) Search and obtain all alternative splicing types of chicken MHC I gene from GenBank database and literature; use Oligo6.31 or PrimerPremier5.0 software to design primer pairs, ...

Embodiment 2

[0078] Example 2 Rapid identification of the alternative splicing type of the test pig TLR4 gene

[0079] The difference between this example and Example 1 is that the gene to be tested is domestic pig TLR4 gene, and the primer pair is: upstream primer 5'-GACCCTTGCGTGCAG-3'; downstream primer 5'-CTCTGGATAGGATTTCC-3'. There are three gene alternative splicing types in this gene: TLR4 complete type, TLR4 exon 2 complete deletion type, and TLR4 exon 3 partial deletion type; the sequences of each gene are as follows:

[0080] (1) Complete gene sequence of TLR4

[0081] 5'-GACCCTTGCGTGCAGGTGGTTCCTAACATTAGTTACCAATGCATGGAGCTGAATTTCTACAAAATCCCTGACAACATCCCCACATCAGTCAAGATACTGGACCTGAGCTTTAACTACCTGAGTCATTTAGACAGCAATAGCTTCTCCAGCTTTCCAGAACTGCAGGTGCTGGATTTATCCAGATGTGAAATTCAGACAATTGACGATGATGCATATCAGGGCCTAAATTACCTTTCCACCTTGACACTGACGGGAAATCCTATCCAGAG-3';

[0082] (2) Partial deletion gene sequence of exon 3 of TLR4

[0083] 5'-GACCCTTTGCGTGCAGGTGGTTCCTAACATTAGTTACCAATGCATGGAGCTGAATTTCTACAAAAT...

Embodiment 3

[0087] Example 3 Rapid Identification Test Alternative Splicing Type of Longan MEE70 / MSll Gene

[0088] The difference between this example and Example 1 is that the gene to be tested is the longan MEE70 / MS11 gene, and the primer pair is: upstream primer 5'-CGGTTGTTGCTCATC-3'; downstream primer 5'-CTGGGCTTCCATATC-3'. There are two types of gene alternative splicing in this gene: MEE70 / MS11 complete type, MEE70 / MS11 exon 4-7 deletion type; wherein, each gene sequence is as follows: (1) MEE70 / MS11 complete type gene sequence

[0089] 5'-CGGTTGTTGCTCATCAGAGTGAGGTTAACTGCTTAGCATTCAATCCCTTTAATGAATGGATTTTGGCGACTGGGTCTACTGATAAGATGGTTAAGTTATTTGATTTGCGCAAGATTAGCACGGCACTTCACACATTTAGTCACAAGGAGGAAGTTTTCCAAGTTGGATGGGACCCAAAGAGTGAGACTATTTTAGCATCTTGTTGTCTTGGTAGAAGGTTGAAGGTGTGGGATCTTAGGAGGATCGATGAGGAACAGACACTAGAGGATGCCGAAGATGGTCCACCAGAGTTGCTTTTTACTCATGGTGGTCACACGAGTAAAATCTCAGATTTTTCATGGAACCCATGTGAAGATTGGGTTATTGCTAGCGTAGCGGAAGATAATATTCTTCAAATATGGCAGATGGCAGAGAACATTTACCATGATGAAGATGATTTACCTGGAGATGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
correlation coefficientaaaaaaaaaa
Login to View More

Abstract

The invention provides a method for fast identifying the type of gene alternative splicing. The method comprises the steps of preprocessing, sample detection and data analysis. Compared with the prior art, the method has the advantages of being wide in application range, small in number of experiment steps, short in time consumed in detection, simple in result interpretation, large in detection flux, high in accuracy, small in error and low in detecting cost. Meanwhile, according to the detecting method, inverse transcription, amplification and qualititation of a gene segment are completed in a closed tube at one step, and the method is very simple, convenient to use, suitable for clinical sample studies and especially suitable for analyzing the alternative splicing types of clinical peripheral blood and tissue sample genes. Clinical experiments verify that the method is fast, efficient and practical, has high theory and application value on the aspect of studying gene alternative splicing, and therefore application prospects are very wide.

Description

technical field [0001] The present invention relates to gene alternative splicing, in particular to a method for identifying gene alternative splicing type and its application, especially a method for identifying the alternative splicing type of a specific eukaryotic gene in a specific tissue at a specific period and its application. Background technique [0002] Alternative splicing (also known as alternative splicing) refers to the process of producing different mRNA splicing isoforms from a pre-mRNA through different splicing methods (selecting different combinations of splicing sites). Alternative splicing is an important mechanism for increasing proteome diversity from a relatively simple genome, and the splicing process is regulated by the interaction of multiple cis-acting sequences and trans-acting factors. [0003] It is predicted that the human genome may have about 35,000 genes, Drosophila about 14,000, and the simple model organism nematode about 19,000 genes. T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q2561/113C12Q2527/107
Inventor金元昌勾越张政陈修月任朝云张舟宋国娇李玉峰赵攀
OwnerHUNAN UNIV OF SCI & TECH